ROFL

Wow.

"they evolve into a person?"

"In practice yes, over billions of years, a time period btw that is evidenced in scientific fields including chemistry, physics, geology, astronomy and biology."

If God told you to kill me, would you?

thanksbyelady

Though some might argue that not all e.coli turn into humans.....the apriori.politici species are among one that remain fungus.

Your elected officials, ladies and germs. No wonder we're screwed

It's as sad as it is hilarious. How'd dumbasses like this ever get into the position they're in? Oh right... other, voting dumbasses

I'll never get over how people like this must be walked through each part of deduction, the scientific method and how it applies to evolution, when their whole ideological model consists of:

"I did it."
"OK."

http://videosift.com/video/Futurama-I-don-t-want-to-live-on-this-planet-anymore

I believe she is referring to the experiments led by Richard Lenski, which is beautiful and interesting. Trying to explain it to a creotard is like.. like.. trying to explain an experiment that directly, conclusively and once and for all disproves the worldview of the person you are explaining it to.

Evolution is real. However to imply or believe that all things evolved from the utter basic building blocks to what we have today is absurd.

The lady in the white sweater at 1:00 pretty much summed it up for all of us before we got to comment.

What's the alternative theory you propose?

More absurd than some magical omnipotent being wishing us into existence? I'd sooner go with aliens seeding the early earth with life than "God did it".

Honestly abiogenesis is a lot less absurd than say, quantum or dark energy. Not that I'm suggesting those don't exist, just that our natural intuition about something is frequently false.

It's quite difficult to get your head around the scales involved with evolution. Billions of years and many trillions of individual organisms all mutating in positive and negative ways, producing weaker and stronger offspring.

It's only absurd if you can't envision those scales, which admittedly is quite a mind bender at times.

First of all, I like your standpoint, nothing wrong with that. We simply don't know, maybe the big bang was an imploding black hole in another plane of existence, creating our own 4 dimensional reality. Maybe it was an omnipotent being looking like a giant spider with Panda bears instead of arms, maybe both.
Although Occam razor would suggest the first alternative (which on a grand scale sounds equally ridiculous to me), we still don't know.

And secondly ask yourself this (I don't mean you in special bobknight), "Is it even possible to consider biological evolution in isolation from everything else?". I don't think thats possible, first we need something like really huge stars to create heavy atoms (i mean everything with more protons than helium, that's not what a chemist would call heavy). We need smaller stars that don't burn up that fast and deliver energy, we need a planet in the right distance to this star. Ohh and the planet itself doesn't have the properties to sustain life from the beginning, earth also had to "evolve" to the kind of planet that was able to sustain life and therefore start the biological evolution. There are many more of these requirements and they also needed to "evolve" from this huge pile of energy called the big bang.

It is absurd, but it is also evidently, and provably true. It is a fact. Back in the days of Darwin one could perhaps make the case that the idea of common descent was perhaps stretching it far, but the discovery and later sequencing of DNA makes it a slam dunk. There is no other even remotely reasonable conclusion you can make, but the one that says you are related to a tomato. and elephants, and chimps, and E.Coli and shrimps and everything else that has DNA. Not only do we all share the same basic system (why doesn't some species use different nucleic acids or something else to replicate?) But we share the SAME CODE. Even with our most distant cousins (something like E.Coli) have long strands of DNA code in common with us. The four nucleic acids of DNA , represented by the letters A,T,C and G are laid down by the thousands in patterns like: AAAATTCGGGTATTTATTTGCAAACCTTTT, and then we find the SAME CODE in completely "unrelated" species. But thats not all, the relatedness of the code is excactly what you would expect in the taxonomic tree, and infact it is now THE method for figuring out exactly how related one species is to another, and drawing the correct tree.

So all life IS related, which means it all has a common ancestor, which lived some 3 billion years ago. Which also means it had to be a simple form that diverged into all that we now have. And that process is evolution, and the main driving forceof evolution, by far, is natural selection. So we know that this process happens and that it can create amazing things from really much simpler things. All we need to postulate is the capability to self-replicate for those first replicators. Admittedly, this is pretty hard to envision, but we do know that all the basic building blocks (organic molecules) could arise spontaneously through non-replication. But we may never know exactly how it started, it would be something simple, like some organic molecules spontaneously forming RNA strands, which break in two and each half collects its counter-parts and form two RNA strands and so on...

LOL @ you dumbasses. The engineers brought our DNA to earth in a little jar of black ochre jelly and then drank it and fell in a river.

Hush you. We're blocking that out.

It makes so much more sense when you paraphrase Scott like that.

I think as a former Creationist (old earth creationist, the idiocy of young earth creationist stunned me, for the Earth to be 6,000-10,000 years old would require God purposely setup evidence to prove it wasn't that old, which some dismiss as "God chose what is foolish in the world to shame the wise") I can speak to the problem here is that Christian and right wing media reinforce certain key thoughts that keep a Christian from understanding or accepting even the basics of the theory. You can get them to understand evolution is why you need a new flu shot each year, or why pesticides stop working after a time, but they think that is a different type of evolution. The image painted in the mind of a creationist is that one day in the African plains an ape or monkey was having a baby, and rather than be an ape or monkey it was a human... and that somewhere nearby another ape/monkey had to have another human for them to mate and continue offspring... there is no understanding of the scale and time involved to get from A to Z... they think that the A to Z is the same as A to B and ignore B to Y in the evolutionary timeline. They also misuse the word evolution to apply to the big bang and abiogenesis ("see they use the biblical word Genesis too") as that is what is reinforced again and again. They are reinforced to misunderstand the word "theory" to think it is just a random guess... and make no mistake, the fact that the word theory doesn't mean a guess/idea and that evolution doesn't go from A to Z without going through B-Y first has been made clear to those who teach creationism, but they don't care, there is money to be made in deluding the church goers into holding onto the old ignorance, rather than embrace the truth... of course then you run the risk of some of them learning the truth and then going "I wonder what the hell else they lied to me about..." but most never will open their minds to the concept that even if God is real, perhaps the creation account and great flood are not literal events, but parables intended to teach a lesson...

The other key issue that makes it really hard for religious people to 'get' evolution on a core level is their understanding of evolution as teleological - goal-directed - and their understanding of humanity as the 'end goal' of evolution. Even if they get the geological scales involved and they get the basic genetic mechanism of evolution, they still see it as a process intended to create humans; as us being the 'best' life forms. That fucks their ability to actually understand evolution all to shit, because they can't get their minds around the randomness of it, and the fact that protozoa that haven't changed much for the last several hundred million years are clearly earth's evolutionary 'winners.' Sometime I think it would be easier for these fundamentalists to deny the existence of God than to accept that the existence, shape and role of humanity on earth is just a meaningless accident.

They are talking about Papa Lenski... My buddies dad! LOL.

*promote papa lenski

Promoting this video back to the front page; last published Tuesday, January 22nd, 2013 12:11pm PST - promote requested by MycroftHomlz.

Stupid people have no respect for intelligence.