I had to quit discussing things like this in private thanks to bob (and his sock puppets). I refuse now because he likes to be a completely different person in private, admitting things he would never admit in public conversation, admitting he’s lying, that Trump is an awful human being, etc. he ruined it.
Sorry…replying publicly.

If you can’t/won’t answer one simple question, there’s no point. I’m sick of answering all of yours and having you dodge mine….especially sick of it since you refuse to even acknowledge my answers and pretend I didn’t give you a straight answer. I refused to answer one red herring, biased, loaded, off topic question because I disagreed wholeheartedly with its premise, but answered every other you asked.
I feel like you’re wasting my time here..

I must point out, the question you continue to ignore trumps every question you asked….how can you deny the rights of legal women to compete in publicly funded contests as women? It’s their constitutional right to not be discriminated against based on gender. Case closed. Nothing overrides that legality.

I answered your question 3 times now. If you can’t understand, why keep trying? One last time, but I’m out. I’m not going to answer you without the same consideration.

There is no evidence that xx vs xy denotes one automatically has an advantage based on just chromosomal arrangements. None.

Women CAN be stronger, faster, better than men in most arenas, and vice versa. Genetic gender may indicate a likelihood random men will be stronger than random women, it alone does not dictate biological differences that can/will be advantageous in athletics. Hormone levels, hormone therapy, supplements, mental fortitude, training, environment, opportunities, dna, rna, diet, HGH, etc can all go into creating (or erasing) those possible physical “advantages” you reference, not just chromosomal arrangements. Since that’s true, discrimination based on chromosomal arrangements is not just wrong and illegal, it’s ignorant and evil.

I’ve been over that 3 times, now 4. I’ve given specific examples. What’s the issue in comprehension? Are you even reading? What?!

I’m bored of this. We won’t get anywhere with this one sided discussion where only one of us answers questions or pays attention to the answers. Fuggetaboutit. This isn’t a discussion

Have a nice day. Bye.

If you are talking policies that govern individuals, average is meaningless, you need to include the outliers. What I really said was, on average it’s somewhat true a bit more than half the time….with many exceptions, so incredibly far from a rule…far from “I can agree”.

You said “ Are you saying you do not believe that people who are biologically male(By which I mean XY) have an advantage in athletics over people who are biologically female(by which I mean XX)?”.
I pointed to one instance where (I assume) chromosomal males do not have an advantage over a chromosomal female in an athletic field….just an example of why I don’t believe it’s always true that people who are biologically male(By which I mean XY) have an advantage in athletics over people who are biologically female(by which I mean XX)..one you can’t contradict.

People are never equally gifted or talented, not even with themselves yesterday or tomorrow. I find the premise faulty.

Appears to, so far, in most but not all categories.
In many, the difference is minimal and an exceptional female will surpass males one day in most. Top ranked Kenyan woman already routinely beat top ranked non Kenyan males in long distance running, for one example.

I won’t extrapolate from a temporary skewed position, it leads to ridiculous conclusions….so I won’t be able to agree.
I can agree people believe that.

It’s not just sexual biology. It has nothing to do with genitals. It’s hormones, dna, rna, mental toughness, upbringing, training, health, environment, opportunity, etc. if someone born a woman wants to compete with men, and your position is correct, what’s the harm? If a trans woman, born male but never going through male puberty or taking estrogen and hormone blockers to reverse the effects wants to compete against women, what proof do you have to show any advantage? Two athletes excelling? Out of how many?

Now how expert are you in this field? Expert enough to define the exact point where each person has an advantage vs a disadvantage? I doubt it. But you think it’s fine to deny them the right to participate based on your ignorant assumptions. Do you accept such ignorant, biased assumptions to determine what you may do, how much you may participate in public events? I doubt you would accept it for a second. Think about that.

You want to equate them to non trans people while trying to prove how they’re so different. Pick a lane please.

No matter what your opinion, denying a citizen a chance to compete in public sports is totally unAmerican. I notice how you ignore that, as if to concede it under your breath. It doesn’t go unnoticed that you can’t address that. It IS the point.

Edit : as to the olympics, they have allowed trans gender athletes since 2004. If trans women are really men, why haven’t those records become equal between men and women?

My recollection is, from maybe as early as Feb 2020, immunologists had studied the DNA and rna of the virus and said unequivocally that it was not "created" using any known method of gene manipulation or DNA recoding. Since that's what most people think China is being accused of, it's important to be clear that this possibility was ruled out early and without question....all known methods of creating viruses by gene/DNA manipulation leave tell tale evidence that can identify the exact type/method of manipulation done, and none was found.

It's possible that the lab, through unnatural selection, developed the natural disease into something more dangerous then lost containment...I don't see how, without records indicating they did that, it would be possible to differentiate between that and natural selection in the wild. IMO it's most likely to have spread from wet markets while also being studied in the lab that exists because these diseases are prevalent naturally in the area.

I was supposed to go there this year, only some RNA had to get all uppity!

Great, informed video. Mild nitpick from a scientist - SARS-Cov2 is an RNA virus, while the visuals show DNA...

I cannot figure out what you are trying to debate? That there is no science behind DMT? That there is nothing to DMT? That "spiritual" does not exist? What is your point of this continued conversation? That you are scared of psychedelics? Why do you think such an experience would have been programmed into our head, the most powerful experience a person can have?

I have trouble understanding "spiritual" to be the same as "awesome" or "awe-inspiring", but if thats what you mean by "spiritual", I suppose we agree. I understand "spiritual" to mean "that which concerns the spirits or the spiritual world", ie something supernatural.

I suppose there is little point in continuing this debate, I get a little carried away.. My point ws only that it is unscientific and nonsensical to think that stimulating your brain with chemicals can help you discover some sor of spiritworld or some nonsense like that, the reason I KNOW this, as you put it, is what I've fruitlessly to express over several long comments. Basically, to repeat myself for like the 5th time, it has to do with basic facts of the origin of our brains and so forth, it is now established, beyond any reasonable doubt, that our brains evolved. If you understand what biological evolution is and how it works, you'd know it is the mindless reshuffling of nucleotides acted upon in populations of animals over countless generations, this produces amazing survival machines, and some of them develop brains, and some of those grow big brains.

How do you think DNA evolved over so many years,
DNA probably evolved after RNA, nobody knows exactly how replicating nucleotides started to replicate, it was probably a staggeringly unlikely event, but then there was literally all the time and space in the universe for it to happen..

you ever read Francis Cricks, who helped found DNA, Well, I've read The Double Helix, and I'm currently studying biology and genetics.
what his theory for DNA was? Panspermia. Yeah.
No,
It was speculation, probably tongue-in-cheek that he later regretted. In any case, the argument was based on the fact that the origin of DNA/RNA was an extremely unlikely event, and that if it didn't originate on earth, it could have been brought here from elsewhere. Both options are essentially saying the same thing, that abiogenesis happened and that it later evolved (either here on earth, like most scientist now think, or somewhere else.)

It doesnt really matter whether directed panspermia is true or not, DNA is still strings of molecules that abide by the laws of physics and chemistry. They are not some sort of magical quantum spirit crystals mind-controlled by aliens.
The Universe is a lot trickier than just our basic Science.
Whatever you say boss.

It is absurd, but it is also evidently, and provably true. It is a fact. Back in the days of Darwin one could perhaps make the case that the idea of common descent was perhaps stretching it far, but the discovery and later sequencing of DNA makes it a slam dunk. There is no other even remotely reasonable conclusion you can make, but the one that says you are related to a tomato. and elephants, and chimps, and E.Coli and shrimps and everything else that has DNA. Not only do we all share the same basic system (why doesn't some species use different nucleic acids or something else to replicate?) But we share the SAME CODE. Even with our most distant cousins (something like E.Coli) have long strands of DNA code in common with us. The four nucleic acids of DNA , represented by the letters A,T,C and G are laid down by the thousands in patterns like: AAAATTCGGGTATTTATTTGCAAACCTTTT, and then we find the SAME CODE in completely "unrelated" species. But thats not all, the relatedness of the code is excactly what you would expect in the taxonomic tree, and infact it is now THE method for figuring out exactly how related one species is to another, and drawing the correct tree.

So all life IS related, which means it all has a common ancestor, which lived some 3 billion years ago. Which also means it had to be a simple form that diverged into all that we now have. And that process is evolution, and the main driving forceof evolution, by far, is natural selection. So we know that this process happens and that it can create amazing things from really much simpler things. All we need to postulate is the capability to self-replicate for those first replicators. Admittedly, this is pretty hard to envision, but we do know that all the basic building blocks (organic molecules) could arise spontaneously through non-replication. But we may never know exactly how it started, it would be something simple, like some organic molecules spontaneously forming RNA strands, which break in two and each half collects its counter-parts and form two RNA strands and so on...

Terrific! I imagine that Carl would have really liked this. (Anne? Nick? Sasha--Thoughts? As much as I enjoyed this, I hope the producers keep going and add more time and detail with the amazing journey from self replicating molecules to RNA to single cell organisms to polyps to fish, and also toward the end with what we know of hominid evolution. Very Cool!

The thing I hated the most in the lab was having to constantly deal with formaldehyde - a pretty potent carcinogen. It's used in tissue preservation, so anytime you want to extract some DNA/RNA from formalin fixed paraffin embedded (FFPE) tissue you end up getting a dose of it.

The strangest thing is how in our chemistry labs all the waste chemicals from all our experiments had to be put into one big jar, so there would be this viscous, almost gooey mass of this silvery-orange-black'ish sort of toxic waste which was a combination of all the 30-40 different (already toxic) chemicals put together. That would then need to sit in the lab for a month until waste collection day arrived.

I’m going to respond to your last comment in two parts. The first part regards the god argument in which you have mischaracterized me as being closed minded and of having a bias. I can easily show that I am neither and this is my view on the whole god thing so you can at least understand my view if for nothing else. The second part I will address my primary contention against your methods of argument.

I am willing to listen, however, on its face the statement "I don't care about the whole god argument" indicates both bias and closed-mindedness. It also shows an intellectual incuriousity.

I admit that I don’t believe in a god or gods, or even advanced aliens. I just don’t see any reason to believe any of it. This doesn’t mean that I am saying that god doesn’t exist; I’m saying “I don’t know, but I highly doubt it and I don’t buy it.” What do you find confusing about that?

We have no real reason to suppose from direct evidence that a god, or gods, exist. Do all effects have a cause? Do all causes have an effect? If yes, why do you suppose it’s a god who caused all of the effects that you attribute him to such as the “fine tuning” or “the appearance of design”, why can’t it be something else? By resting on a god hypothesis as the answer to mysterious phenomenon, you are precluding all other answers that are just as good as a god, that have the same amount of direct evidence.

Scientific evidence indicates that time, space, matter and energy all had a finite beginning, making the cause of the Universe timeless, spaceless, unimaginably powerful and transcendent. Those are all attributes of God, and fit an unembodied mind. The fine tuning, information in DNA and appearance of design all point to a creator. Logic itself tells us that the first cause of the Universe must be eternal because nothing comes from nothing and you can't have an infinite regress of causes. Frankly I think it is ridiculous to believe that Universes just happen by themselves, and especially, as the greatest minds of our time are suggesting, out of nothing. Can't you see that when someone says that, it means the emperor has no clothes?

Does the god that you believe in have a cause? If not, how so? By what mechanisms does your god exist but without having had a cause? How can your belief be proven and why should anyone believe it based on rational information? What evidence is there that compels you to believe that your god indeed doesn’t have a cause? These are the kinds of questions that I think you should be asking for yourself. If you resort to “just needing to have faith” as an answer then you are actively avoiding exercising critical thinking faculties.

God is eternal, and He has no beginning or end, so no He doesn't have a cause. A God that was caused by something else wouldn't be God. My evidence is from logic which demands an eternal first cause. Otherwise, you're left explaing how you get something from nothing, which is logically absurd.

Unlike you, I don’t see the appearance of design in the complexity of biological systems or in anything found in nature. I study evolutionary biology, astrophysics, and chemistry for myself because I find it the mechanisms fascinating, not because I’m trying to disprove god.

Biologists must constantly keep in mind that what they see was not designed but rather evolved.

Francis Crick Nobel Laureate
What Mad Pursuit p.138 1988

Biology is the study of complicated things that give the appearance of having been designed for a purpose.

Richard Dawkins
The Blind Watchmaker p.1

Even hardcore skeptics concede there is an appearance of design.

There is inherent beauty in all of it and it’s a shame that most people are ignorant of what we do actually know. While I’m open to the idea that a god designed the system then put it in motion, there just isn’t direct phenomenological evidence that suggest that’s what happened.

The information in DNA is direct evidence that a higher intelligence designed the system.

There is enough information that we do know about speciation to suggest that evolution through natural selection does happen, is happening, and will continue to happen. The genetic code is enough to suggest common ancestry between all living things in a tree like family lineage.

natural selection can weed out some of the complexity and so slow down the information decay that results in speciation. it may have a stabilizing effect, but it does not promote speciation. it is not a creative force as many people have suggested.

Roger Lewin Science magazine 1982

The genetic code also suggests a common designer. As far as your tree claim, you need to research the cambrian explosion. It is quite a let down for gradualists, unfortunately. All the major body types, including the phylum Chordata (thats our phylum), were there from the beginning. We actually have less diversity today, not more.

(on the cambrian explosion)
And we find many of them already in an advanced state of evolution, the very first time they appear. It is as though they were just planted there, without any evolutionary history. Needless to say, this appearance of sudden planting has delighted creationists.

Richard Dawkins - The Blind Watchmaker 1986 p.229

Certainly, we do not know yet exactly how the whole process of DNA or RNA reproduction started, but if we postulate that a god started the process without sufficient evidence, only on the basis that there is no better answer, then we can also postulate that it was an advanced inter-dimensional race of ancients who populate planets with the seed of genetic mechanisms. If we don’t have the answer to how the mechanism got the whole thing started, what’s the difference between those two different origin hypotheses?

I don't postulate that God 'started the process'. I postulate that God spontaneously created everything. You rule out God apriori and thus you accept this just-so story about how life got here. In your eyes, it must have happened. Interpreting the evidence to fit the conclusion isn't very scientific, is it?

Also unlike you, I don’t see what you call “fine tuning” and I also study all sorts of physics, my favorite being astrophysics personally. The term “fine tuning” implies that something above the system changed some dials to a perfect goldilocks range to support what we have right now. This is an interesting idea however I find it to be more prudent to see it the other way around; that what has formed, has only formed because the conditions allow for it, that the environment dictates what can exist. Wherever you look at an environment and find life, you find life that fits into that environment and we also see that when environments change, so to do species change to adapt to the new conditions. We never see an environment change to fit the species.

I don't think you're understanding the fine tuning argument. Many of those finely tuned values, if even moved an inch, would make life impossible in this Universe. Not just improbable, but impossible. The fine tuning is extremely fortuitous to an incomprehensible degree. The odds of these values randomly converging is virtually impossible. For instance, for physical life to exist, the mass density of the Universe must be fine tuned to better than one part in 10 to the 60th power. For space-energy density, it is 10 to the 120th power. That's just two out of dozens of values.

You claim that we haven’t seen macro-evolution taking place? Are you sure about that, how exactly do you know this is true, where did you read this? How do you know that what you are calling macro-evolution is the same thing as what evolutionary biologists call macro-evolution? The fact of the matter is that the fossil record has nothing to say about the most recent research on macro-evolution. It’s a fascinating material and I would suggest that you get out there and find it for yourself. Talk Origins has as list of the studies done on macro-evolution, you can start there if you like.

Yes, evolutionists are trying to dump the fossil record in favor of genetic evidence because the fossil record is actually evidence against their theories. As I've said, common genetics also indicate common designer.

Darwin made a great discovery, that creatures can adapt to environmental conditions. That's something that has hard scientific evidence. What didn't have any evidence was his extrapolation from that to the theory of all life having a common ancestor. He was counting on the fossil record to prove his case but it didn't, which is why he said this:

innumerable transitional forms must have existed but why do we not find them embedded in countless numbers in the crust of the earth? ..why is not every geological formation and every stratum full of such intermediate links?

Geologoy assuredly does not reveal any such finely graduated organic chain, and this perhaps is the greatest objection which can be urged against my theory.

Charles Darwin
Origin of the Species

Here we are 150 years later with billions of fossils and there still isn't any evidence. If Darwin was right, we should have indisputable proof that one species changed into another, but we don't. All we have is a smattering of highly contested transitionals which are all "more or less" closely related, but no true ancestors. When the facts don't match the theory it is time to throw that theory away, but the theory of evolution is the cornerstone of the secular worldview, and it isn't going to die without a fight, no matter how loudly the facts cry out against it.

The question becomes, if there was/is a designer, what was designed first, the creature or the environment? To me, you are suggesting that humans were designed first in the mind of god, and then the environment was finely tuned in order to sustain the idea that god already had for us. Don’t you think this is a little bit too egotistical of a view? If that’s true, what makes everything else necessary? I don’t know if you study astrophysics or astronomy at all but there is a massive amount of stuff out there that has nothing to do with us and if we’re a part of god’s plan, he sure did create a lot of waste.

I'm saying He created all of it at the same time, in six days as Genesis describes. Why is the Universe so large? It could be for a number of reasons, such as that it gives us room to grow. If we were just hitting some sort of wall in space, it would also be a wall in knowledge that we could acquire. If it wasn't as large and complex as it is, we wouldn't be where we are today. Why are solid objects actually mostly composed of empty space? Isn't God wasting all of that space? Or is it integral to His design? Does the fact that almost everything is made up of empty space reduce the significance of solid objects? The size of the Universe doesn't say anything about our importance relative to it. The Heavens also declare the glory of God:

Psalm 19:1-2

The heavens declare the glory of God; and the firmament sheweth his handywork.

Day unto day uttereth speech, and night unto night sheweth knowledge.

To me, if the Christian beliefs are the most accurate representation of reality, god isn’t a very good designer. There millions of ways that he could have done a better job if he is all powerful. Of course, you can revert back to, “we can’t know the mind of god”, or “god works in mysterious ways”, but those aren’t answers, they are just ways of maintaining a pre-existing belief by silencing further inquisition.

Have you ever created a Universe? If not, how then would you know what a superior design would look like?

“Unless you can demonstrate a purely naturalistic origin of the Universe, you have no case against Agency.“

Agency needs to prove itself and so far it isn’t doing a very good job. Science as a whole isn’t making a case against agency and neither am I by suggesting that there are likely to be naturalistic causes. Agency simply isn’t necessary. That is what I think that you don’t understand. It’s that I don’t accept the case for agency until agency can be proven. A suspended judgment is better than an accepted unverifiable and untestable claim.

You can rule out the necessity of Agency when you can explain origins. To say that it is not necessary when you don't know what caused the Universe is not something you can determine.

If you are in any way the kind of person who culturally relates to Christianity then there is nothing that anyone can do for you. It is very difficult to have an intellectually honest conversation with someone whose basis for belief is deeply tied to a sense of culture or social belonging. Challenging your beliefs is synonymous to asking you to become someone else if your beliefs are tightly woven into your identity. The only thing I can ask of you is to ask yourself if what you believe determines how you will process new information that comes to you.

I'll give you a little background on me. I grew up without any religion, and until a few years ago, I was an agnostic materialist who didn't see any evidence for God or spirit. Growing up, I hoped to become an astronomer. I have studied all the things you have mentioned, and although I am just a layman, I know quite a bit about biology, astronomy, physics, etc. Like you, I assumed because of my indoctrination in school and society, that the theory of evolution and other metaphysical theories were well supported by hard evidence. When I became a Christian, I was willing to incorporate these theories into my worldview. It is only upon investigation of the actual facts that I was shocked to find there not only is there no real evidence, but that much of what I had been taught in school was either grossly inaccurate, intentionally misleading, or outright fradulent.

So, you're not dealing with someone who grew up outside of your worldview, who feels threatened by it and is trying to tear it down. You're talking with someone who was heavily invested in it, and even willing to compromise with it, and has turned away from it because of my research, not in spite of it. If it was true, I would want to know about it. Since it isn't, I don't believe in it.

At the very least, you can see now that I am not diametrically opposed to the idea of a creator or agency behind everything. The notion is interesting but I don’t believe that there is enough real credible information to suggest that it’s true.

You are more openminded than I originally gave you credit for, but you definitely have a huge evidence filter made out of your presuppositions.

There are enough logical arguments against the idea of a god or gods existing that the whole notion is worth dismissing.

The only logical argument of any value that the atheists have is the argument from evil, and that has been soundly debunked by plantigas free will defense. Feel free to bring one up though, because I have never seen an atheist offer any positive evidence for his position. "Worth dismissing" = close minded and biased, btw.

If there is as god or gods, they aren’t doing a very good job of making themselves known or knowable.

Do you think that is why 93 percent of the world believes that God exists?

The simple fact is that naturalistic explanations are more useful ideas than any god concept because they provide both predictions that we can verify and help us make decisions about where to study next. No god hypothesis has ever provided either, therefore, in the pursuit of knowledge; the idea of god is useless.

Did you know that the idea that we can suss out laws by investigating their secondary causes is a Christian idea, based on the premise that God created an orderly universe governed by laws? Did you know that modern science got its start in Christian europe? Doesn't seem so useless to me. Science now must assume a little thing called "uniformity in nature" to even do science without the belief that there is a Creator upholding these laws. How do you get absolute laws in an ever changing Universe? What is the evidence the future will be like the past? Can you explain it?

Now you see why naturalistic explanations are predominate in science as the default standard.

It is not that the methods and institutions of science somehow compel us to accept a material explanation of the phenomenal world, but, on the contrary, we are forced by our a priori adherence to material causes to create an apparatus of investigation and set of concepts that produce material explanations, no matter how counterintuitive, no matter how mystifying to the unitiated. Moreover, that materialism is absolute, for we cannot allow a Divine foot in the door.

Richard Lewontin, Harvard
New York Review of Books 1/9/97

No evidence would be sufficient to create a change in mind; that it is not a commitment to evidence, but a commitment to naturalism. ...Because there are no alternatives, we would almost have to accept natural selection as the explanation of life on this planet even if there were no evidence for it.

Steven Pinker MIT
How the mind works p.182

I have faith and belief myself... I believe that nothing beyond those natural laws is needed. I have no evidence for this. It is simply what I have faith in and what I believe.

Isaac Asimov

I see why you say that, and now you know why you believe that, because those who teach you these ideas are doing exactly what I have been saying all along. Suppressing the truth.


>> ^IAmTheBlurr:

I’m going to respond to your last comment in two parts. The first part regards the god argument in which you have mischaracterized me as being closed minded and of having a bias. I can easily show that I am neither and this is my view on the whole god thing so you can at least understand my view if for nothing else. The second part I will address my primary contention against your methods of argument.

I admit that I don’t believe in a god or gods, or even advanced aliens. I just don’t see any reason to believe any of it. This doesn’t mean that I am saying that god doesn’t exist; I’m saying “I don’t know, but I highly doubt it and I don’t buy it.” What do you find confusing about that?

We have no real reason to suppose from direct evidence that a god, or gods, exist. Do all effects have a cause? Do all causes have an effect? If yes, why do you suppose it’s a god who caused all of the effects that you attribute him to such as the “fine tuning” or “the appearance of design”, why can’t it be something else? By resting on a god hypothesis as the answer to mysterious phenomenon, you are precluding all other answers that are just as good as a god, that have the same amount of direct evidence.

Does the god that you believe in have a cause? If not, how so? By what mechanisms does your god exist but without having had a cause? How can your belief be proven and why should anyone believe it based on rational information? What evidence is there that compels you to believe that your god indeed doesn’t have a cause? These are the kinds of questions that I think you should be asking for yourself. If you resort to “just needing to have faith” as an answer then you are actively avoiding exercising critical thinking faculties.

Unlike you, I don’t see the appearance of design in the complexity of biological systems or in anything found in nature. I study evolutionary biology, astrophysics, and chemistry for myself because I find it the mechanisms fascinating, not because I’m trying to disprove god. There is inherent beauty in all of it and it’s a shame that most people are ignorant of what we do actually know. While I’m open to the idea that a god designed the system then put it in motion, there just isn’t direct phenomenological evidence that suggest that’s what happened. There is enough information that we do know about speciation to suggest that evolution through natural selection does happen, is happening, and will continue to happen. The genetic code is enough to suggest common ancestry between all living things in a tree like family lineage. Certainly, we do not know yet exactly how the whole process of DNA or RNA reproduction started, but if we postulate that a god started the process without sufficient evidence, only on the basis that there is no better answer, then we can also postulate that it was an advanced inter-dimensional race of ancients who populate planets with the seed of genetic mechanisms. If we don’t have the answer to how the mechanism got the whole thing started, what’s the difference between those two different origin hypotheses?

Also unlike you, I don’t see what you call “fine tuning” and I also study all sorts of physics, my favorite being astrophysics personally. The term “fine tuning” implies that something above the system changed some dials to a perfect goldilocks range to support what we have right now. This is an interesting idea however I find it to be more prudent to see it the other way around; that what has formed, has only formed because the conditions allow for it, that the environment dictates what can exist. Wherever you look at an environment and find life, you find life that fits into that environment and we also see that when environments change, so to do species change to adapt to the new conditions. We never see an environment change to fit the species.

You claim that we haven’t seen macro-evolution taking place? Are you sure about that, how exactly do you know this is true, where did you read this? How do you know that what you are calling macro-evolution is the same thing as what evolutionary biologists call macro-evolution? The fact of the matter is that the fossil record has nothing to say about the most recent research on macro-evolution. It’s a fascinating material and I would suggest that you get out there and find it for yourself. Talk Origins has as list of the studies done on macro-evolution, you can start there if you like.

The question becomes, if there was/is a designer, what was designed first, the creature or the environment? To me, you are suggesting that humans were designed first in the mind of god, and then the environment was finely tuned in order to sustain the idea that god already had for us. Don’t you think this is a little bit too egotistical of a view? If that’s true, what makes everything else necessary? I don’t know if you study astrophysics or astronomy at all but there is a massive amount of stuff out there that has nothing to do with us and if we’re a part of god’s plan, he sure did create a lot of waste. To me, if the Christian beliefs are the most accurate representation of reality, god isn’t a very good designer. There millions of ways that he could have done a better job if he is all powerful. Of course, you can revert back to, “we can’t know the mind of god”, or “god works in mysterious ways”, but those aren’t answers, they are just ways of maintaining a pre-existing belief by silencing further inquisition.

“Unless you can demonstrate a purely naturalistic origin of the Universe, you have no case against Agency.“

Agency needs to prove itself and so far it isn’t doing a very good job. Science as a whole isn’t making a case against agency and neither am I by suggesting that there are likely to be naturalistic causes. Agency simply isn’t necessary. That is what I think that you don’t understand. It’s that I don’t accept the case for agency until agency can be proven. A suspended judgment is better than an accepted unverifiable and untestable claim.

If you are in any way the kind of person who culturally relates to Christianity then there is nothing that anyone can do for you. It is very difficult to have an intellectually honest conversation with someone whose basis for belief is deeply tied to a sense of culture or social belonging. Challenging your beliefs is synonymous to asking you to become someone else if your beliefs are tightly woven into your identity. The only thing I can ask of you is to ask yourself if what you believe determines how you will process new information that comes to you.

At the very least, you can see now that I am not diametrically opposed to the idea of a creator or agency behind everything. The notion is interesting but I don’t believe that there is enough real credible information to suggest that it’s true. There are enough logical arguments against the idea of a god or gods existing that the whole notion is worth dismissing. If there is as god or gods, they aren’t doing a very good job of making themselves known or knowable. The simple fact is that naturalistic explanations are more useful ideas than any god concept because they provide both predictions that we can verify and help us make decisions about where to study next. No god hypothesis has ever provided either, therefore, in the pursuit of knowledge; the idea of god is useless. Now you see why naturalistic explanations are predominate in science as the default standard.


>> ^shinyblurry:

The thumbnail image for this video has been updated - thumbnail added by geo321.

>> ^shinyblurry:

A mind created and designed it, therefore a mind is involved, therefore it is an invalid example..


So, by this argument, if we live in a deist universe, in which the universe was created but the creator pays it no mind, then abiogenesis and evolution by natural selection are completely plausible. That's an interesting position, it does not really help you here.

>> ^shinyblurry:

Abiogenesis is unproven because there is no evidence, it is just metaphysics. It's your faith that it is true. It is not the only coherent explanation, it is just the explanation that you have to believe because you have ruled out an intelligent designer apriori.

You seem to not understand the meaning of apriori. A few hundred years ago everybody in the western world, at least claimed to, believe the creation myth of genesis. We got to here from there, don't pretend your ideology has not had a chance, you were in charge of the game, we called your bluff, you just had nothing in your hand, you still don't.

Evolving molecules exist, they came into being at some point after it was possible for them to exist in this universe. The only non-magic hypotheses we have are based on a naturalistic model where these molecules are generated by a series of non-evolving processes. The gaps in the chemical record are very much like the gaps in the fossil record used to be, we have not filled them all, but neither have we found one that can not be crossed, and no reason to think they will not be filled.

>> ^shinyblurry:
Here is the hypothesis


The ID position is stated there in four parts, the last three follow from common decent, and the first one is either false, like all Behe's examples, or undemonstrated. It is mathematically possible that there is irreducible complexity somewhere, just as with faeries and unicorns, absence of evidence is not evidence of existence.

All the Discovery Institute links were painful in their fail. DI is a propaganda organization, only one of their links discusses any scientific discovery, and it actually makes no ID claims. The rest of the articles either make no claim, or have been shown to be false. If Well's article is going to be your flagship falsifiable ID position, fine, but you should probably know it's already been falsified here .

>> ^shinyblurry:

There is obviously a concrete difference since life doesn't come from non-life, and has never once been observed doing so. You have everything in the world to prove here.

This is your premise, and your conclusion, draw the line, and I will show you something on either side that confounds your "distinction". If you can't define the problem, I can't show it's flaws. Refusing to define your terms may get you by in theology, we are talking chemistry here, chemistry does not "work in mysterious ways".

>> ^shinyblurry:

if our mental processes are just chemical reactions, then there is no reason to believe anything is true. If our mental states have their origin in non-rational causes, rationality can't be trusted. You can't know if the rationality we have from evolutionary processes is discerning the truth of the world or not.

Ontology can't help you here, gods, since the can intervene, make it more difficult to make truth claims, not easier.

>> ^shinyblurry:

The reason it is labeled magic is because there is no proof.

There is no proof of anything. There is evidence of RNA/DNA metabolism, there is evidence of general chemical probability, there is no evidence for irreducible complexity, or anticipatory design in any non lab built genome. You can scream about nonexistent, and unneeded proof all day, science follows the evidence.

I have claimed that there are methods to synthesize information that do not require the interaction of a mind. I have provided an example of one such system.

You object, but without either asserting that the simulation is a mind, or that it does not synthesize information, but instead you make some vague assertion about how it's instead not an example.

A mind created and designed it, therefore a mind is involved, therefore it is an invalid example..

Abiogenesis is, like all real knowledge, unproven. None the less it is, at present, the only coherent explanation for what can be demonstrated to exist.

Abiogenesis is unproven because there is no evidence, it is just metaphysics. It's your faith that it is true. It is not the only coherent explanation, it is just the explanation that you have to believe because you have ruled out an intelligent designer apriori.

There is no ID hypothesis, Behe came the closest to actually trying, and any competent high school biology student could pick his little charade to pieces in a few hours with a half decent encyclopedia.

Here is the hypothesis

http://www.ideacenter.org/contentmgr/showdetails.php/id/1156

Here is a story about ID being published in a biology journal making predictions for cancer research

http://www.discovery.org/a/2627

I am arguing not that there are no differences in the world, but that there is no concrete distinction between life and chemistry. You can assume there is, you can assert there is, but until you can demonstrate that there is I have nothing to disprove.

There is obviously a concrete difference since life doesn't come from non-life, and has never once been observed doing so. You have everything in the world to prove here. Everything in the Universe is made up of atoms, does that mean there is no difference between you and me? Is there no difference between a duck and a neutron star? You can't just say that because there are trivial similarities that they are the same thing.

And if you think like that, and you just believe we are all chemicals in motion, then you can't trust your own mind because if our mental processes are just chemical reactions, then there is no reason to believe anything is true. If our mental states have their origin in non-rational causes, rationality can't be trusted. You can't know if the rationality we have from evolutionary processes is discerning the truth of the world or not. Even Darwin realized this:

"With me the horrid doubt always arises whether the convictions of man's mind, which has been developed from the mind of the lower animals, are of any value or at all trustworthy. Would any one trust in the convictions of a monkey's mind, if there are any convictions in such a mind?"

The bottom right hydroxyl group is the only difference between RNA and DNA, to suggest that molecules can't lose parts, is to argue that the universe is not as it observably is.

Since the step you clearly label (MAGIC) in the RNA-> DNA path is so obviously trivial, why should anybody believe that the other step you label (MAGIC) is any more complex
?
Well this is plainly false. RNA to DNA is far more probable than ROCKS to RNA. The reason it is labeled magic is because there is no proof. It doesn't mean that they are both equally likely. It is less likely by large orders of magnitude.

The magic is RNA self-replication:

http://www.lifesorigin.com/chap10/RNA-self-replication-3.php

And if you had bothered to do any real research, you would see that the leap from soup to these complex molecules is anything but trivial..here is a list of just of basic issues...

http://www.godandscience.org/evolution/chemlife.html

Some quotes for you:

Instead of revealing a multitude of transitional forms through which the evolution of the cell might have occurred, molecular biology has served only to emphasize the enormity of the gap. We now know not only of the existence of a break between the living and non-living world, but also that it represents the most dramatic and fundamental of all the discontinuities of nature. Between a living cell and the most highly ordered non-biological system, such as a crystal or a snowflake, there is a chasm as vast and absolute as it is possible to conceive....

Molecular biology has also shown that the basic design of the cell system is essentially the same in all living systems on earth from bacteria to mammals. In all organisms the roles of DNA, mRNA and protein are identical. The meaning of the genetic code is also virtually identical in all cells. The size, structure and component design of the protein synthetic machinery is practically the same in all cells.

In terms of the basic biochemical design, therefore no living system can be thought of as being primitive or ancestral with respect to any other system, nor is there the slightest empirical hint of an evolutionary sequence among all the incredibly diverse cells on earth. For those who hoped that molecular biology might bridge the gulf between chemistry and biochemistry, the revelation was profoundly disappointing."

Dr. Denton, Ph.D (Molecular Biology),
An evolutionist currently doing biological research in Sydney, Australia

Now we know that the cell itself is far more complex than we had imagined. It includes thousands of functioning enzymes, each one of them a complex machine in itself. Furthermore, each enzyme comes into being in response to a gene, a strand of DNA. The information content of the gene (it's complexity) must be as great as that of the enzyme it controls.

A medium protein might include about 300 amino acids. The DNA gene controlling this would have about 1,000 nucleotides in its chain, one consisting of a 1,000 links could exist in 41000 different forms. Using a little algebra (logarithms) we can see that 41000 = 10600. Ten multiplied by itself 600 times gives us the figure '1' followed by 600 zeros! This number is completely beyond our comprehension."

Frank Salisbury,
Evolutionary biologist

Perhaps an "effort", but not a method, or a hypothesis. ID makes no predictions, it simply tries to find arguments to prop up a baseless assumption, that is the opposite of science.

If any ID proponent, or any theologian for that matter, can demonstrate even one example of anything true that their ideology can reliably tell us that we don't already know I will admit that it has predictive power, and that it could qualify as a hypothesis, and then eventually a theory. I'm betting you can't find one.

I did, see above. Here is a bunch more: http://www.discovery.org/a/2640


>> ^dgandhi:
>> ^shinyblurry:
What I insist is that you substantiate your claims, which you have failed to do.
I have claimed that there are methods to synthesize information that do not require the interaction of a mind. I have provided an example of one such system.
You object, but without either asserting that the simulation is a mind, or that it does not synthesize information, but instead you make some vague assertion about how it's instead not an example.
>> ^shinyblurry:
Abiogenesis is purely metaphysics and unproven.
Abiogenesis is, like all real knowledge, unproven. None the less it is, at present, the only coherent explanation for what can be demonstrated to exist.
There is no ID hypothesis, Behe came the closest to actually trying, and any competent high school biology student could pick his little charade to pieces in a few hours with a half decent encyclopedia.
Given two possibilities, one being unlikely, and the other being false, I'll go with unlikely.
>> ^shinyblurry:
So you acknowledge that information is trivially synthesized, by
non-minds? That's the opposite of your original claim. Is that a
retraction?
No, see above.

You said, and I quote: "if you already have DNA, you can certainly expect a cell to form."
Do you mean that DNA must already have the information required to do so? because lots of DNA does not, otherwise are you asserting that DNA is somehow "mind", which you claim would be required for that information to come into being?
>> ^shinyblurry:
The distinction between "life" and "non-life" does not exist.
So there is no difference between you and a rock? I can admit I see similarities, heart wise..:)
Let's see some evidence for your claim that there is no difference between life and non-life.

I am arguing not that there are no differences in the world, but that there is no concrete distinction between life and chemistry. You can assume there is, you can assert there is, but until you can demonstrate that there is I have nothing to disprove.
You can't disprove unicorns, I can't disprove the life boundary, and we have no reason to believe either exists.
>> ^shinyblurry:
It's not false. This is your pathway to DNA: RNA - (MAGIC) - DNA This is your pathway to RNA: ROCKS - (MAGIC) - RNA Just because you can get RNA to self-replicate doesn't automatically mean it is either likely or plausible this could happen.
Please consider this image: http://en.citizendium.org/images/thumb/f/f6/RNA_base_vs_DNA_base.jpg/350px-RNA_base_vs_DNA_base.jpg
The bottom right hydroxyl group is the only difference between RNA and DNA, to suggest that molecules can't lose parts, is to argue that the universe is not as it observably is.
Since the step you clearly label (MAGIC) in the RNA-> DNA path is so obviously trivial, why should anybody believe that the other step you label (MAGIC) is any more complex?
>> ^shinyblurry:
It is an effort to empirically detect whether the "apparent" design in nature, which biologists acknowledge, is actual design. It is only useless to you because you have ruled out design apriori, which is just simply ignorant.
Perhaps an "effort", but not a method, or a hypothesis. ID makes no predictions, it simply tries to find arguments to prop up a baseless assumption, that is the opposite of science.
If any ID proponent, or any theologian for that matter, can demonstrate even one example of anything true that their ideology can reliably tell us that we don't already know I will admit that it has predictive power, and that it could qualify as a hypothesis, and then eventually a theory. I'm betting you can't find one.

>> ^shinyblurry:
What I insist is that you substantiate your claims, which you have failed to do.

I have claimed that there are methods to synthesize information that do not require the interaction of a mind. I have provided an example of one such system.

You object, but without either asserting that the simulation is a mind, or that it does not synthesize information, but instead you make some vague assertion about how it's instead not an example.

>> ^shinyblurry:
Abiogenesis is purely metaphysics and unproven.

Abiogenesis is, like all real knowledge, unproven. None the less it is, at present, the only coherent explanation for what can be demonstrated to exist.

There is no ID hypothesis, Behe came the closest to actually trying, and any competent high school biology student could pick his little charade to pieces in a few hours with a half decent encyclopedia.

Given two possibilities, one being unlikely, and the other being false, I'll go with unlikely.

>> ^shinyblurry:
So you acknowledge that information is trivially synthesized, by
non-minds? That's the opposite of your original claim. Is that a
retraction?

No, see above.


You said, and I quote: "if you already have DNA, you can certainly expect a cell to form."

Do you mean that DNA must already have the information required to do so? because lots of DNA does not, otherwise are you asserting that DNA is somehow "mind", which you claim would be required for that information to come into being?

>> ^shinyblurry:


The distinction between "life" and "non-life" does not exist.

So there is no difference between you and a rock? I can admit I see similarities, heart wise..:)

Let's see some evidence for your claim that there is no difference between life and non-life.


I am arguing not that there are no differences in the world, but that there is no concrete distinction between life and chemistry. You can assume there is, you can assert there is, but until you can demonstrate that there is I have nothing to disprove.

You can't disprove unicorns, I can't disprove the life boundary, and we have no reason to believe either exists.

>> ^shinyblurry:
It's not false. This is your pathway to DNA: RNA - (MAGIC) - DNA This is your pathway to RNA: ROCKS - (MAGIC) - RNA Just because you can get RNA to self-replicate doesn't automatically mean it is either likely or plausible this could happen.

Please consider this image: http://en.citizendium.org/images/thumb/f/f6/RNA_base_vs_DNA_base.jpg/350px-RNA_base_vs_DNA_base.jpg

The bottom right hydroxyl group is the only difference between RNA and DNA, to suggest that molecules can't lose parts, is to argue that the universe is not as it observably is.

Since the step you clearly label (MAGIC) in the RNA-> DNA path is so obviously trivial, why should anybody believe that the other step you label (MAGIC) is any more complex?

>> ^shinyblurry:
It is an effort to empirically detect whether the "apparent" design in nature, which biologists acknowledge, is actual design. It is only useless to you because you have ruled out design apriori, which is just simply ignorant.

Perhaps an "effort", but not a method, or a hypothesis. ID makes no predictions, it simply tries to find arguments to prop up a baseless assumption, that is the opposite of science.

If any ID proponent, or any theologian for that matter, can demonstrate even one example of anything true that their ideology can reliably tell us that we don't already know I will admit that it has predictive power, and that it could qualify as a hypothesis, and then eventually a theory. I'm betting you can't find one.