@ 5:47 was white then black pepper, and the eggs are x-large but prolly look bigger from the placement of the camera...low heat on the skillet so they cooked slowly enough sunny-side-up for the whites to fully solidify on top from steam coming off the tomato-puree

I had fun with this-2 days of egg roll devastation (30 the first run and 25 spring rolls the day after), an insanely rich chicken-potato cheese casserole of sheppard's I doctored a bit (helped his ratings when judged)...and 3 rounds of Eggdillas so far, fondly revisiting the Huevos Rancheros Hangover Treatment Plan-NOTE: the sauteed tomatoes I added at the end were not part of the original recipe-I slapped sliced tomato in the hot skillet and reduced them with chopped green onions, and a couple of hot sauces...The judge enjoyed this better than the Gouchcogganger sauce but the sauce was a stand-alone hit.

PM me dystop and we'll exchange info, get that shirt right out to ya. If you decline the offer, feel free to give it up to second place suzy should you be so inclined.

So all we need now is for someone to sift these videos, first one is done, one to follow-Sorry shepppard, I did not take anything but stills of your dish...very boring process, full of the same excitement of watching your mom in the kitchen.

It is absurd, but it is also evidently, and provably true. It is a fact. Back in the days of Darwin one could perhaps make the case that the idea of common descent was perhaps stretching it far, but the discovery and later sequencing of DNA makes it a slam dunk. There is no other even remotely reasonable conclusion you can make, but the one that says you are related to a tomato. and elephants, and chimps, and E.Coli and shrimps and everything else that has DNA. Not only do we all share the same basic system (why doesn't some species use different nucleic acids or something else to replicate?) But we share the SAME CODE. Even with our most distant cousins (something like E.Coli) have long strands of DNA code in common with us. The four nucleic acids of DNA , represented by the letters A,T,C and G are laid down by the thousands in patterns like: AAAATTCGGGTATTTATTTGCAAACCTTTT, and then we find the SAME CODE in completely "unrelated" species. But thats not all, the relatedness of the code is excactly what you would expect in the taxonomic tree, and infact it is now THE method for figuring out exactly how related one species is to another, and drawing the correct tree.

So all life IS related, which means it all has a common ancestor, which lived some 3 billion years ago. Which also means it had to be a simple form that diverged into all that we now have. And that process is evolution, and the main driving forceof evolution, by far, is natural selection. So we know that this process happens and that it can create amazing things from really much simpler things. All we need to postulate is the capability to self-replicate for those first replicators. Admittedly, this is pretty hard to envision, but we do know that all the basic building blocks (organic molecules) could arise spontaneously through non-replication. But we may never know exactly how it started, it would be something simple, like some organic molecules spontaneously forming RNA strands, which break in two and each half collects its counter-parts and form two RNA strands and so on...

Hobbit Hole Breakfast: Two eggs fried right into the center of grilled Cheddar bun halves. Served with two strips of bacon and crispy hash browns topped with melted shredded Cheddar cheese and bacon.

Shire Sausage Skillet: Shire sausage with seasoned red-skinned potatoes, sautéed mushrooms and fire-roasted peppers and onions served on a sizzling skillet. Topped with shredded Cheddar cheese and two eggs.

Frodo's Pot Roast Skillet: Slow-cooked pot roast, herb-roasted carrots, celery, mushrooms and onions over broccoli and seasoned red-skinned potatoes served on a hot sizzling skillet. Topped with shredded Cheddar cheese and served with dinner bread.

The Ring Burger: A hand-pressed burger topped with Pepper Jack cheese, bacon, sautéed mushrooms and mayo on a grilled Cheddar cheese bun. Crowned with three crispy onion rings and served with lettuce, tomato, red onions, pickles and a side of wavy-cut French fries.

Gandalf's Gobble Melt: Tender sliced turkey breast and savory stuffing topped with melted Swiss cheese placed on grilled potato bread with a cranberry honey mustard spread. Served with your choice of side and gravy for dipping.

Dwarves' Turkey & Dressing Dinner: Tender sliced turkey breast, savory stuffing, gravy and cranberry sauce served with your choice of two sides and dinner bread. Feeds a band of Dwarves. Or one hungry human.....or Bear.

Lonely Mountain Treasure: Seed Cake French Toast cut into nine squares and served with a side of cream cheese icing for dipping.

Radagast's Red Velvet Pancake Puppies: Six bite-sized round red velvet Pancake Puppies® made with white chocolate chips and sprinkled with powdered sugar. Served with a side of cream cheese icing for dipping.

Bilbo's Berry Smoothie: Made with a delicious blend of raspberries, blueberries, pomegranate and nonfat yogurt.

Lone-Lands Campfire Cookie Milk Shake: A thick hand-dipped milk shake with a delicious blend of premium vanilla ice cream and s'mores cookie pieces topped with a dollop of whipped cream. Served with a little extra in the tin.

No, they are not the same thing, and they are not creationist terms.

Yes, they are in fact the same thing, and yes, I know creationists didnt come up with the terms, predictably, since they have never come up with a single useful term or idea in the history of everything. They can be useful terms to describe the short-term and long-term effect of evolution, but creationist use the term to shield themselves from admitting that they deny reality. Lets just take one example: genetic variation, according to creationists then, genetic variation is real and actually happens, your genes are slightly different from other human genes, ie: there is variations within a species.

But this is the same kind of variation there is BETWEEN species, its the SAME FREAKING THING, but when the difference is large enough, individual organism can no longer breed to produce fertile offspring. That is in fact the definition of "species". Conceptually, there is no difference between the genetic difference between you and me and the genetic difference between you and a tomato, its just MORE difference.

I honestly dont know how to respond to this time=miracle nonsense, the point is that because there is variation and mutations, speciation will happen over long stretches of time, now you might say "biologists sure needs lots of time for evolution to work" but the thing is that other, unrelated fields of study, like chemistry, physics and cosmology have independently reached conclusions about how old the universe is, and its billions of years old. We KNOW that, not from inventing a number large enough to allow evolution to work its "miracles", but because its the only logical conclusion based the available evidence.

The correlating data you are looking at is a hall of mirrors. Radiometric data is based on uniformitarian assumptions. The light travel time is based on similar assumptions. Embedded in all of the estimations of an old age are unprovable assumptions that have no empirical evidence to prove they are true. They are in fact unknowable.

Everything in that paragraph is wrong. These things are NOT based on assumptions, but empirical evidence, calculations and experiments. In fact, the knowledge has not only been confirmed by experiments and evidence, and as I tried to explain earlier, YOU ARE RELYING ON TECHNOLOGY BASED ON THAT KNOWLEGDE TO READ THIS SENTENCE. It is literally being proved right in front of your eyes.

In reply to this comment by ant:
>> ^PlayhousePals:

Why did the salmon cross the road? [to get to the other stream] =o)


[throws rotten tomatoes at you]

Tough crowd =oO

but interestingly, yes on image and i hate my name here, it assumes i'm critiquing something. meh. i'll change it.
t-minos tomato, at your service.
i do music
www.soundcloud.com/t-minos
and work with spines
www.ncrtheory.org
and i'm part of cirque du cliche

God damn Bobby, where's your sense of urgency? You're trying to remove a hive of killer bees, not pick tomatoes from the garden....

@ReverendTed
Many issues to address here, but first, some clarifications. My analogies (wonky as they are) were to point out the immorality of the “you’ve got to live with the consequences” stance, they were not about who’s harmed. But speaking of harm, it would be more ethical to let the two analogical characters “suck it up” than to demand of a woman she bring an unwanted pregnancy to term. In the first cases, there is only one victim, but in the latter there are two. When I say abortion is “punishment enough”, what I mean is that it is already a disagreeable outcome of mistake-making/poor-choice-making, while obliging a woman to give birth to (and raise) an unwanted child not only negatively affects the mother’s life, but that of the child as well; it is a disproportionate price to pay for the former and completely unfair for the latter. Hence, imo, abortion is by far the lesser of two “evils”.

Adoption instead of abortion is “a non-solution and worse” for several reasons. First, there are already more than enough children already alive who need parents, and you know very well that most people prefer making their own than adopting, so many of these will never have a family (not to mention the often inferior care-giving in foster homes and social centres). Now imagine that every abortion is replaced with a child given up for adoption; can you not see the horror? It’s that many more neglected lives, not to mention the overall problem of overpopulation.

I’m going to go on a slight tangent, but a relevant one. I have a certain amount of experience with humanitarian aid in Africa, and one thing that causes me no end of despair is the idiotic, selfish way much of it is performed. Leaving aside corruption, proselytization, etc., the “West” pours food and medicine into Africa with that whole “life is sacred” “feed the poor” mentality – good intentions of course – but with disastrous results because education and contraception (not to mention abortion) are almost always left out, even discouraged, with the support of the usual religious suspects (remember the pope on condoms causing aids?). The result is simple, and simply appalling: despite aid and funds increasing globally every year, starvation and child mortality continue to rise. Why? Because the people being barely maintained keep making kids who grow up to starve and die in turn, instead of focusing on the education of one or two children to get them out of the vicious cycle (there is another argument to be made about the education of women, but I’m ranting enough as is).

The point of this digression is to show that the non-pragmatic “all life is sacred” stance is terribly counter-productive, and the same holds for abortion (viz: on adoption above). As for lack of pragmatism, the same goes for your comment on abstinence:
I appreciate that "don't have sex if you can't accept being pregnant" is not a magical incantation that makes people not have sex, but it has to be a part of it, because no method of contraception is 100% effective, even if used correctly.
What you’re saying basically is “people shouldn’t have sex unless they’re ready for childbearing/-raising”, which is absurd when one considers human nature and human relations.

All of the above arguments weigh into the question of the “ball of cells” vs “human being/identity”. The “sacred life” stance is one of quantity over quality, and in the long run devalues human life altogether. To quote Isaac Asimov on overpopulation: “The more people there are the less one individual matters”. In the abortion debate, what we have is one side so intent on protecting the abstract “life” that they disregard the lives of the two individuals in question, namely the “individual who is” (the mother) and the “individual who might be” (the child). The former is already a human individual, with memories, relationships, a personality, etc. The latter is not. The abortion question takes into account the future quality of life not only of the mother but of the would-be child as well, something the anti-abortion stance does not. Abortion doesn’t end an individual’s life, it prevents a ball of cells from becoming one. Here is where the religious aspect is crucial, because while embryologists see a complex mass of cells with no capacity for cognition/sensation, superstitious people assign an individual “consciousness” or “soul” to it, thus making abortion feel like murder instead of like the removal of a tumour. The question of potential is an emotionally manipulative one that does not hold up to criticism, because as @packo sarcastically (and the Monty Python brilliantly ) point out, you can go a long ways up the stream of potential.

I like the first half of @gorillaman’s tomato analogy for that reason (the second half is hyperbolic absurdity), that it underlines what is important in the debate: the living “thing”’s capacity for sensation/cognition/interaction. If you grew up with a tumour on your body which giggled when you tickled it and cried when you hit it, you would probably think twice before getting rid of it. That does not mean I’m categorically against late-term abortions, but for me the scale seriously tips between the 20-25th weeks when the nervous system of the foetus centralises. Of course, it is preferable that should an abortion take place it would be before the foetal stage, for the sake of medical and psychological comfort, but unfortunately one cannot always know so soon that one is pregnant.

I didn't want to join this tired discussion but decency requires someone oppose the appalling 'birth is magic - never kill a newborn' consensus. This is superstitious nonsense; wads of animal meat aren't supernaturally imbued with humanity by being shoved through a cunthole.

There's confusion and arbitrariness everywhere on this simple topic because nobody bothers to ground their moral sense in any kind of rational foundation. They look at a cute baby and their instincts and emotions destroy any hope of intelligent thought. Forget abortion, stop thinking about babies and heartbeats, it's moronic; go back and work on your basic understanding of ethics.

Why don't we kill people? Is it because we haven't been given a mandate; that there's no explicit cosmic distinction to separate one lump of matter from another, giving one the right to disrupt the other? Then we're all just bits of physics bumping into each other, and there's still no reason to prefer a foetus to its host; no more than a cancer sufferer to their tumour or indeed the whole of humanity to a grain of sand.
Is it because they're alive? Then we'd better learn to photosynthesise, because our existence requires the daily destruction of life. Life has no inherent value. It's just one peculiar way that our universe is shaped by its bizarre physical laws, with no mystery or significance - unapprehending molecules forced into the illusion of purpose.
Is it because they're human? Why do we value that species, is it only that it happens to be our own, or is there some particular quality of humanity beside their kind that requires moral treatment? There must be, or else to be consistent we would say that when a rock shatters another it commits a terrible crime among rocks, because one may not harm ones own kind.
Isn't it that we don't kill people because we recognise that the aggregation of their perception and understanding of reality, their cognitive excellence and continuity of personal identity gives rise to the new phenomenon of Mind - I give Mind a capital letter in that silly and somewhat religious way because it is the absolute centre and cause of moral necessity; without it there is simply no reason to be moral. Only by the application of Mind can there be a reality to be moral in. Mind is the universal source of all meaning.

So the question you ask yourself when considering the rights of a creature is 'what is the condition of its intellect; to what extent is it conscious; is it Mind?'

Everybody already agrees with me if they had the sense to see it. If I could produce a tomato with a mind equivalent to a human, which I was able to demonstrate could think and talk and feel and reason like any one of us, would we be happy to chop it into a salad? What about a human with the mind of a tomato? Well they already exist; they're called babies.

>> ^spoco2:

Looks good. Only thing I don't know from that is how much wine and how much chopped tomatoes.
I would imagine it's one tin of chopped tomatoes (as it's usual to use the tinned ones in these), but the wine?
I might try this tonight actually.


I make it with one tin and a large glass of wine and it is beeeeeyotiful

Looks good. Only thing I don't know from that is how much wine and how much chopped tomatoes.

I would imagine it's one tin of chopped tomatoes (as it's usual to use the tinned ones in these), but the wine?

I might try this tonight actually.

you guys are all funny. 55 comments! I like the idea of whole mushrooms, whole cherry tomatoes, and lovely dense, well-toasted bread. The eggs are really extraneous to that tasty base. That and the butter.

SILENCE!>> ^probie:

Booooo! (throws a tomato)