Honestly..A Shrimp On A Treadmill has been added as a related post - related requested by Zawash on that post.

Motivational Shrimp Workout has been added as a related post - related requested by Zawash.

Adding the Benny Hill Theme to Anything Makes it Funny has been added as a related post - related requested by Zawash.

*related=http://videosift.com/video/Motivational-Shrimp-Workout
*related=http://videosift.com/video/Adding-the-Benny-Hill-Theme-to-Anything-Makes-it-Funny

Thanks for the article. It kinda reads like an add for Jennifer Mathers' 'octopuses are smart' book. Her 2008 Consciousness and Cognition paper does a better job at laying out the most cephalopod behaviors impressive behaviors:
http://www.sciencedirect.com/science/article/pii/S1053810006001504
. Don't get me wrong; I think cephaolopods totally awesome, but I don't see the case for them being cognitive leaps and bounds above other invertebrates. The behaviors that they are capable of are found elsewhere among inverts, yet people (often encouraged by Mathers or her coauthors on that book) seem to imply they are basically eight armed dogs of the sea:

Behavioral conditioning in the lab (which Mathers likes to call "learning") - Bees, butterflies
Moving objects to close off burrows - mantis shrimp
Carrying objects as temporary refuges - crabs
Individual recognition - wasps, lobsters?, mantis shrimp.
Complex spatial navigation - ants, bees.
Learning via observation - I'm not aware of other inverts that do this, but the cephalopod evidence is also pretty weak.

Maybe there are some more recent, and more convincing results?

Hmm. This could have been done better. I was hoping to see visualizations of:
* Birds' extremely high-speed vision; fast enough to fly through trees' foliage.
* Jumping spiders with 2 focusable main eyes and 6 other eyes.
* Mantis shrimp with their 6+ receptors, including UV, IR and polarization.

Mantis shrimp are my favorite type of shrimp

To clarify, mantis shrimp don't create sonoluminescence in the same way that pistol shrimp do, by "squeezing their claws together". They create it when the smack things, like snails, really hard with their raptorial appendages.

Another interesting angle to think about: We have all of this scientific interest in sonoluminescence, and the host of cool hypotheses mentioned, not just because it's cool. ..but because, among other things, the Navy REALLY wants to understand the process of cavitation, and throws money at research on the subject. Why? because ship and submarine propellers also create cavitation, and they want to create war machines that are not loud and whose propellers last longer.

MMmmmmm... a few things to consider adding to a basic water/oil/savories type stock for anyone not wanting to use meat or chicken:

Tamari, Bragg's All-Purpose Seasoning, or there's this really good brand of vegetarian boullion Better Than Boullion, comes in about 5 varieties, including lobster and shrimp-You might also try some Traditional Molé, the Mexican paste used for tamales and other dishes...

This is a great basic procedural for most broth based, hearty soups-Nice one, oritteropo

Mmmmmm, loves me some Split Pea Soup now that I'm thinking about it....

Mantis Shrimp are the devil. Seriously, they punch so fast the water boils around it!

http://theoatmeal.com/comics/mantis_shrimp

http://www.wbrz.com/news/man-pleads-for-help-on-hood-of-truck-in-baton-rouge/

One guy is a shrimp vendor. Other guy has a truck. Truck guy steals shrimp sign. Shrimp man jumps on truck. Truck guy drives to police station.

Wait, what?

It is absurd, but it is also evidently, and provably true. It is a fact. Back in the days of Darwin one could perhaps make the case that the idea of common descent was perhaps stretching it far, but the discovery and later sequencing of DNA makes it a slam dunk. There is no other even remotely reasonable conclusion you can make, but the one that says you are related to a tomato. and elephants, and chimps, and E.Coli and shrimps and everything else that has DNA. Not only do we all share the same basic system (why doesn't some species use different nucleic acids or something else to replicate?) But we share the SAME CODE. Even with our most distant cousins (something like E.Coli) have long strands of DNA code in common with us. The four nucleic acids of DNA , represented by the letters A,T,C and G are laid down by the thousands in patterns like: AAAATTCGGGTATTTATTTGCAAACCTTTT, and then we find the SAME CODE in completely "unrelated" species. But thats not all, the relatedness of the code is excactly what you would expect in the taxonomic tree, and infact it is now THE method for figuring out exactly how related one species is to another, and drawing the correct tree.

So all life IS related, which means it all has a common ancestor, which lived some 3 billion years ago. Which also means it had to be a simple form that diverged into all that we now have. And that process is evolution, and the main driving forceof evolution, by far, is natural selection. So we know that this process happens and that it can create amazing things from really much simpler things. All we need to postulate is the capability to self-replicate for those first replicators. Admittedly, this is pretty hard to envision, but we do know that all the basic building blocks (organic molecules) could arise spontaneously through non-replication. But we may never know exactly how it started, it would be something simple, like some organic molecules spontaneously forming RNA strands, which break in two and each half collects its counter-parts and form two RNA strands and so on...

This happens with ?pistol shrimp? right?

I'm sure it might of made an exception for that shrimp.

This is why you always order shrimp. Because there's no way they can make a (cat/dog/deer/?) look like a shrimp.

It's funny because Shrimp are tasty and he's next to be eaten!