search results matching tag: postulate
» channel: learn
go advanced with your query
Search took 0.000 seconds
Videos (9) | Sift Talk (1) | Blogs (0) | Comments (155) |
Videos (9) | Sift Talk (1) | Blogs (0) | Comments (155) |
Not yet a member? No problem!
Sign-up just takes a second.
Forgot your password?
Recover it now.
Already signed up?
Log in now.
Forgot your password?
Recover it now.
Not yet a member? No problem!
Sign-up just takes a second.
Remember your password?
Log in now.
Neil deGrasse Tyson: We Live in a Cosmic Shooting Gallery
There's a greater chance that one (or more) of the stars within about 6000 light years or so could give off a gamma ray burst that would wipe out any life in the solar system, no matter where we hid it. It's been postulated the previous-to-the-Yucatan-asteroid large scale die-offs could have happened due to GRB.
Drone Fleet To Expand- Civilian Death Statistics
seems like everyone at TYT goes to the Cenk school of saying "Of course" after every postulation...
Seriously some overexaggerated journalism going on over there.
Creationist Senator Can E. Coli Turn Into a Person?
It is absurd, but it is also evidently, and provably true. It is a fact. Back in the days of Darwin one could perhaps make the case that the idea of common descent was perhaps stretching it far, but the discovery and later sequencing of DNA makes it a slam dunk. There is no other even remotely reasonable conclusion you can make, but the one that says you are related to a tomato. and elephants, and chimps, and E.Coli and shrimps and everything else that has DNA. Not only do we all share the same basic system (why doesn't some species use different nucleic acids or something else to replicate?) But we share the SAME CODE. Even with our most distant cousins (something like E.Coli) have long strands of DNA code in common with us. The four nucleic acids of DNA , represented by the letters A,T,C and G are laid down by the thousands in patterns like: AAAATTCGGGTATTTATTTGCAAACCTTTT, and then we find the SAME CODE in completely "unrelated" species. But thats not all, the relatedness of the code is excactly what you would expect in the taxonomic tree, and infact it is now THE method for figuring out exactly how related one species is to another, and drawing the correct tree.
So all life IS related, which means it all has a common ancestor, which lived some 3 billion years ago. Which also means it had to be a simple form that diverged into all that we now have. And that process is evolution, and the main driving forceof evolution, by far, is natural selection. So we know that this process happens and that it can create amazing things from really much simpler things. All we need to postulate is the capability to self-replicate for those first replicators. Admittedly, this is pretty hard to envision, but we do know that all the basic building blocks (organic molecules) could arise spontaneously through non-replication. But we may never know exactly how it started, it would be something simple, like some organic molecules spontaneously forming RNA strands, which break in two and each half collects its counter-parts and form two RNA strands and so on...
Evolution is real. However to imply or believe that all things evolved from the utter basic building blocks to what we have today is absurd.
Why the moon hoax would have been impossible
"...the apparent omnipotence of special effects increases linearlly with your birth date."
"Whoa." -K. Reeves
As far as postulating this cat's motivation for making this video??-This guy loves picking things apart and entertaining people was my first guess.
Bill Nye: Creationism Is Just Wrong!
At present this concept of design is just castle-in-the-sky nonsense. Empty piffle. A complete non-starter.
This is why the "mere mention" of "design" will get you "banned" from peer-review, because you could just as well have made a "mere mention" of Bigfoot and the loch ness monster in your zoology report, it's a big tell to your peers that you are a nut who fails to understand the nature of evidence and science, and a big sign that you are in for some fuzzy logic and dumb assumptions instead of solid science.
Design is a better hypothesis for the information we find in DNA, and the fine tuning we see in the physical laws. The reason design is a non-starter is because the idea this Universe was created by anyone is anathema to the scientific community:
Even if all the data point to an intelligent designer, such an hypothesis is excluded from science because it is not naturalistic."
S. C. Todd,
Correspondence to Nature 410(6752):423, 30 Sept. 1999
It is not that the methods and institutions of science somehow compel us to accept a material explanation of the phenomenal world, but, on the contrary, we are forced by our a priori adherence to material causes to create an apparatus of investigation and set of concepts that produce material explanations, no matter how counterintuitive, no matter how mystifying to the unitiated. Moreover, that materialism is absolute, for we cannot allow a Divine foot in the door.
Richard Lewontin, Harvard
New York Review of Books 1/9/97
No evidence would be sufficient to create a change in mind; that it is not a commitment to evidence, but a commitment to naturalism. ...Because there are no alternatives, we would almost have to accept natural selection as the explanation of life on this planet even if there were no evidence for it.
Steven Pinker MIT
How the mind works p.182
After essentially nullifying and disproving everything we have learned about biology the last 200 years, you still have all the work ahead of you, I'm afraid. You now have to build a completely new framework and model for every single observation ever made in biology that makes sense of it all and explains why things are the way they are. Shouting that a thing is "complex" is not cutting it, I'm afraid. You need a new theory of DNA, Immunology, Bacterial resistance, adaptation, vestigal organs, animal distobution, mutation, selection, variation, genetics, speciation, taxonomy... well, as Dobzhansky put it: "Nothing in biology makes sense except in the light of evolution" That quote is more relevant than ever.
Your error here is conflating micro and macro evolution. Creation scientists believe in micro evolution and speciation. That is part of the creationist model of how the world was repopulated with animals after the flood. Macro evolution, the idea that all life descended from a universal common ancestor, is not proven by immunology, bacterial resistance, adaptation, animal distribution, mutation, seclection, variation, speciation, taxonomy etc. The only way you could prove it is in the fossil record and the evidence isn't there. They've tried to prove it with genetics but it contradicts the fossil record (the way they understand it). So Creationists have no trouble explaining those things..and common genetics points to a common designer.
You dont have to trust scientists, most of the EVIDENCE is RIGHT FUCKING THERE, in front of you, in your pocket, in your hand, around your home, in every school, in every home, in every post office or courtroom, in the streets. ACTUAL REAL EVIDENCE, right there, PROVING, every second, that the universe is billions of years old.
Every scientist since Newton could be a lying sack of shit, all working on the same conspiracy, and it would mean fuck all, because the evidence speaks for itself.
The earth is definately NOT ten thousand years young.
Have you ever heard of the horizon problem? The big bang model suffers from a light travel time problem of its own, but they solve it by postulating cosmic inflation, which is nothing more than a fudge factor to solve the problem. First, it would have to expand at trillions of times the speed of light, violating the law that says nothing can travel faster than the speed of light. There is also no theory compatible with physics that could explain the mechanism for how the Universe would start expanding, and then cease expanding a second later. It's poppycock. See what secular scientists have to say about the current state of the Big Bang Theory:
http://www.cosmologystatement.org/
As far as how light could reach us in a short amount of time, there are many theories. One theory is that the speed of light has not always been constant, and was faster at the beginning of creation. This is backed up by a number of measurements taken since the 1800s showing the speed of light decreasing. You can see the tables here:
http://www.answersingenesis.org/articles/cm/v4/n1/velocity-of-light
@shinyblurry
I have a concession, perhaps a confession to make. An admission if you will. I accept your thesis:
QualiaSoup - Substance Dualism (Part 1 of 2)
The claim is that there is a special substance that is our consciousness, not that it causes our consciousness.
Those who propose that this is true usually attempt to support this with arguments showing not only do we not yet have any explanation for how consciousness could arise solely from physical matter (which is true), but we cannot in principle show that consciousness could arise from matter (which is debatable). If it is not possible to explain consciousness in terms of matter only, then we have to posit a non-physical substance--or at least non-physical properties. (The philosophers who argue for non-physical properties are called property dualists, like David Chalmers, and should be contrasted with substance dualists like Plantinga.) So, according to dualist philosophers of mind, postulating a non-physical substance is not an unnecessary complication, but an essential element of any complete account of the mind.
The arguments themselves can get very complicated. Philosophy of mind is a sonuvabitch.
>> ^messenger:
If someone's going to propose that there's a special substance that causes our consciousness and is non-physical, it has to be explained how this different substance creates consciousness AND how it interacts with physical objects. To propose an as-yet undetected type of physical matter (similar to how "dark matter" has mass, but remains undetected) only requires explanation of how it creates consciousness. Proposing that it's "non-physical" adds complexity, and doesn't provide any answers. It's a dodge.
@GeeSussFreeK
It's possible that we could know all the physical properties by empirical investigation, eventually. Why not? And if we can create robot intelligence, it might become superior to our own, as in chess. It might then create yet another higher form of intelligence, and so on until one is created that can derive all the physical laws of the universe and communicate them to us with proofs. We do have more than a billion years before the sun dries up all our water. Maybe we've got time.
A Glimpse of Eternity HD
Don't try and pawn this off on me. It's not my "excuse". I'm closed only to one idea: of my being absolutely certain about anything. I'm not closed to any other idea, period. You have failed to convince me. That's why I don't accept your story. And after all this, you revealed yourself to be absolutely certain of your own judgement that your numinous experiences are coming from God.
Let me get this straight..you're completely closed to the idea of being absolutely certain of something. Think about that for a minute and see if you can spot the inherent contradiction contained within this idea.
If I say there is absolute truth, and someone says no there isn't, and I say are you absolutely sure about that?, this isn't a trivial question. That's what I used to think, that it was some kind of cheap trick, and ultimately meaningless. Don't be like I was and just dismiss this without giving it a great deal of thought. The fact is, you can't deny the idea of absolute truth without confirming it. It's not a cheap parlor cheap of logic, it is a revelation of the framework of reality, of how things really work. That there really is a certain truth, and everything you ultimately believe, flawed logic and all, ultimately points to it. It actually could be no other way. There is a ground for everything we know and understand. The atheist says though that's he is standing on air. The issue is that subjective beings can't know anything about objective reality so they grope around in the dark trying to understand what truth is. An atheism has no route to get beyond his subjective understanding. The only way you can understand truth then is by the light of revelation. IE, someone without objective understanding (an omniscient being) would have to enlighten you. If you've never seen light then you won't understand what darkness is. Jesus said if the light in you is darkness, how great is that darkness!
What I believe is that you were not systematic in trying to understand your experience. When you woke up from it and figured out that you were being led down a path to insanity, you just wrote the whole thing off as being entirely in your mind. I would liken this to coming home one day and finding a group of thieves moving furniture out of your house and loading it into a truck. You ask them what they're doing and they say that they are a moving company and that you called them and set up an appointment 2 weeks ago to move you out, and don't you remember? Oh wow, you say, it must have skipped my mind! It looks like it was just a rash idea of mine, really sorry for this inconvenience! You then proceed to help them move your furniture back into your house.
As you're moving everything back in, you notice the door has been busted open and the house has been ransacked. You ask them about this and they say that just earlier you were here trying to let them into house but you couldn't find your key so you kicked the door in because you didn't want to keep them waiting. You then tore the house apart looking for your keys, and when you found them you left to go get something to eat and that's where you've been this whole time. Pondering this you decide that if you could forget about calling them in the first place then you could most certainly forget about doing all of those other things too.
So you finally get everything back in the house and you again apologize profusely for wasting their time, but as they are leaving, they say don't worry about it because we were never here. We're just part of a dream you're having. Goodbye! You think to yourself, considering the memory problems I've been having, this seems very reasonable. The next day a friend stops by and asks you what happened to your house. Oh, it was all a bad dream, you say. I apparently did all of this in my sleep, but it's over now, not to worry!
I don't know what your experience was; typically, they try to convince you that you're some kind of Messiah-like figure, or that reality is centered around you in some way. What I do know is that things happened to you which you cannot explain; signs and wonders, strange "coincidences", etc. These were the signposts in your journey that reinforced your paradigm and kept you on that road. You want to believe that it was all in your head rather than a strategic plan to destroy you, so you chalk it up to delusion. It wasn't all delusion, though; you were being herded down a path, probably with the goal of getting you to kill yourself, and it's only because they went too far that you woke up from that spell.
You have failed to convince me. That's why I don't accept your story.
I can't convince you of anything. This isn't an intellectual problem that you're having, it is an issue of your heart. Only God can convince you, but your heart is hardened towards Him and you refuse to come near to Him.
And after all this, you revealed yourself to be absolutely certain of your own judgement that your numinous experiences are coming from God.
That's just what I've been saying all along, that there is a certain truth, and God reveals it to those who seek Him. That truth is Jesus Christ. You've admitted that God could convince me, so it isn't an inherently irrational position.
All you're telling me is that you are convinced of something, and FWIW, I believe that you are. You have no grounds to believe that your human perceived conviction is warranted, especially given that you know of many other humans who are equally convicted about things that contradict what you believe. That alone should give you doubt about your convictions, as it gives me doubt. If it doesn't give you doubt, you're not being rational. What's more likely: that you alone are correct among all the millions of equally convicted people, or that all equally convicted people, including you, are wrong? What makes you so special?
Nothing makes me special; I simply responded to Gods calling. I can explain why people follow false religion in imitation of the true God, which is that Satan blinds the eyes of unbelievers so that they cannot know the truth about God. He backs up their experiences with supernatural signs and wonders so that they believe they are on the right path. Satan is an imitator of God:
2Co 11:13 For such are false apostles, deceitful workers, transforming themselves into the apostles of Christ.
2Co 11:14 And no marvel; for Satan himself is transformed into an angel of light.
2Co 11:15 Therefore it is no great thing if his ministers also be transformed as the ministers of righteousness; whose end shall be according to their works.
I DO doubt my own existence -- at least, I don't take it as fact that I exist. I could be a brain in a vat, etc. I don't accept my own senses either as categorical evidence. I live as if they're accurate because it's instinctive and it serves me to do so. Skepticism is not ignorance. Accepting something absolutely and uncritically is ignorance. You expect me to accept your word on faith. Why should I believe you? You're just some random person on their internet soapbox who claims to have visions of god. See how stupid it would be for me to change my life because of that? You wouldn't.
I don't think you're actually that skeptical, because I haven't really seen you critically examine your own presuppositions. You say that you don't have any preference for the truth, but that is clearly not true. You are very slanted in favor of a liberal/humanistic/naturalistic mindset, and you oppose any ideas which contradict it. You clearly do accept some things, like evolution for instance, as the gospel truth. This is very inconsistent with your statements about uncertainty. You've seen the human capacity to delude itself, so you keep saying, but you don't seem to question the thought process that leads you to any of these conclusions.
The reason I came to be a Christian, and no one ever witnessed to me by the way, is because I wanted to know the truth and God showed me what it is. I had sufficient evidence from God to give my life to Jesus, and then Jesus completely transformed me and made me a new person. I didn't expect any of that to happen. I had no idea what it would mean to become a Christian. But it did happen, supernaturally, and I found out later that it matched up to everything the bible said would happen. It's one thing to use confirmation bias to make a bunch of coincidence and happenstance into some kind of experience of God. It's another to be transformed at the core of your being into an entirely new person, losing all the negatives and gaining an unlimited supply of peace, joy, hope and love. Even more so when it happens within a moment in time. I've seen miracles, and I've seen things like demon possession. I am certain because God made me certain, but there is plenty of evidence to justify my certainty.
You are certain about God's revelation to you because God has given you certainty of it. That's tautology, if you're a rational agent.
Actually, it's circular reasoning. You will find that every inductive argument suffers from this problem. You cannot actually ultimately justify a single one of your beliefs to me. The conversation could go like this:
You: (objection to a stated fact or belief)
Me: Is that a rational statement?
You: Yes, it is logical.
Me: How do you know it is logical?
You: Because I reason it to be so.
Me: How do you know your reasoning is valid?
You: Because I reason it to be so.
Repeat ad infinitum. You've admitted that you can't trust your senses, and you just assume that you're rational because it's instinctive, which provides you no ultimate justification for anything you believe. That you're telling me it's wrong to use circular reason is absurd since everything you believe is based on it.
Circular reasoning is not necessarily fallacious because you cannot point to an ultimate authority for any claim without using it. Look at the issues this problem of induction causes when it comes to proving scientific theory:
"Joel Feinberg and Russ Shafer-Landau note that “using the scientific method to judge the scientific method is circular reasoning”. Scientists attempt to discover the laws of nature and to predict what will happen in the future, based on those laws. However, per David Hume's problem of induction, science cannot be proven inductively by empirical evidence, and thus science cannot be proven scientifically. An appeal to a principle of the uniformity of nature would be required to deductively necessitate the continued accuracy of predictions based on laws that have only succeeded in generalizing past observations. But as Bertrand Russell observed, “The method of ‘postulating’ what we want has many advantages; they are the same as the advantages of theft over honest toil”
http://en.wikipedia.org/wiki/Circular_reasoning
You cannot use empirical evidence to prove empiricism is valid, just as you can't use the scientific method to prove the scientific method is valid. Therefore science cannot be proven scientifically! It needs an ultimate justification which cannot be proven inductively. Therefore, you would have to use a deductive argument by presupposing the uniformity of nature to justify the continued accuracy of the predictions of science. But again, just assuming the uniformity in nature leads you to the same problem. The only evidence you have that the future will be like the past is in the past. Therefore it would be fallacious reasoning to say the future will be like the past because of the past.
This is where the problem comes in for the atheist, because he must use viciously circular reasoning, which is always fallacious. I can point to God to justify logic, truth, the uniformity in nature, and my own rationality. These concepts don't make any sense in an atheistic worldview, because there is no way to justify them. My reasoning isn't viciously circular..I can point to an ultimate authority. Your reason is viciously circular because you must point to yourself as the authority.
You want God to be real so you deny all evidence even to other *possibilities*, let alone facts.
I didn't originally go looking for God. He tapped me on the shoulder. I didn't become a Christian because I wanted God to be real, I became a Christian because the evidence indicated He is real.
I don't want anything in particular to be real. I only want to be as sure as possible of what I do believe.
I don't think you want the Christian God to be real, and would prefer that He wasn't. What you can be sure of is that you cannot ultimately justify any of your beliefs.
Yes, of course a god could convince you, but just because you're convinced, doesn't mean it was God who did it. That would be a faulty syllogism. Minds can play the most amazing tricks on people. That's documented fact.
How is it that when you have evidence that confirms your belief, it's faulty, but when you reject that evidence, it's rational? Just because you can potentially falsify an idea doesn't mean it has been falsified. I have a path to the truth, as you've admitted. God could make me certain, and He could reveal truth, so it isn't irrational to believe it, considering the overwhelming evidence that I have received, and continue to receive, each and every day. When God touches your life, you have a justified true belief in Him. In every case, when God makes someone certain, they are going to justified in saying that they're certain. You would say all these people are delusional, but you have no way to be able to tell the difference. Only the individual could really know that they've been touched by God. The only way you could find out is if you were yourself touched by God. That's what I've been trying to tell you all along. I can't convince you, but God can. He loves you and He is waiting for you to soften your heart and seek His face. That is the only thing which will prove or disprove my claim.
>> ^messenger:
stuff
A Glimpse of Eternity HD
I would test it, if I could. By “God”, I’m assuming you’re still talking about Yahweh specifically, and not just any random god-type entity. If that’s the case, then I’ve already falsified the claim that the Bible is perfect, so that argument is gone.
You haven't falsified it. If you have, show me where. If you're referring to Matthews lineage using Chiastic structure, that isn't an imperfection. Chaistic structure is a literary device, so Matthews genealogy is not giving us the entire line, but rather like an artistic summation of it. To say it is wrong would be like telling a painter his painting is wrong.
If you’re merely making a deist claim, then I can’t argue with you. I take no position on deism other than if some deity created the universe and set it in motion, I have no reason to believe it cares about humans, and it certainly has made no edicts that I perceive as to how I should live my life.
Since you have no argument against a potential God, and couldn't tell whether you were living in His Universe or not, then how would you know if this God cares about humans or if it has laid down any edicts about how you should live your life?
You’re not listening to me. Seriously. I do have ways of determining which story is more likely. Occam’s razor is the best for this problem. The complexities introduced by faith in Yahweh and the Bible are necessarily more complex than the problems they solve. They are also blind faith (I'm talking about the vast majority of the faithful, and about what you're recommending I do), which is willful self-delusion. The theories that physicists and biologists have come up with are quite convincing, especially if you understand how science works.
I have been listening to you and what I have found is that if you can find some kind of excuse to dismiss something that seems even potentially legitimate, then you run with it. You only seem interested in trying to falsify the question, because you apparently have already decided it isn't true. You don't have any real evidence to prove it, but in previous conversations you have said you see no reason to bother thinking about it. In short, you don't care.
You say I'm talking about blind faith, and I'm not. I believe what I believe because God convinced me of its truth. I had no reason to believe it otherwise, and I wouldn't. I am telling you that if you draw near to God, He will draw near to you. He loves you and wants you to know Him. You just don't want to know Him and that is the problem.
Neither do you understand the law of parsimony. The law states that in explaining a given phenomenon, we should make as few assumptions as possible. Therefore, if we have two theories which are equal in explanatory power, but one has fewer assumptions, we should choose the one with fewer assumptions. However, a more complex theory with better explanatory power should be chosen over a more simplistic theory with weaker explanatory power. I think John Lennox kind of sums this all up at 3:00
Agreed. I find myself in an environment in which my species was capable of evolving. It says nothing of how statistically improbable it is.
You were created in your parents womb; this says nothing about evolution. It only says that you have some way to come into existence, personally. It says nothing about the particulars of how that came to be.
Disagree. I’m lucky that of all the possible combinations of molecules that could have come together to create our terrestrial environment, the right ones came together to create life, then the right DNA strands combined to eventually create me. I’m lucky, sure, but given the length of time we’ve had, there’s no reason I should be surprised, especially when there's no reason to assert that this is the only universe.
There is no reason to assert it isn't, either. In a finely tuned Universe, it is more plausible to believe it was designed rather than it just happened to be one Universe out of trillions that implausibly just looks like it was designed because if you have enough Universes eventually one will form that appears that way. Remember Occams Razor?
You ask why multiple universes are more likely than a deity? Because you and I both know for sure there is at least one universe, so positing some more of them is less of a stretch than asserting a self-contradictory entity, alien to our objective experience, defying any consistent and meaningful description, so vastly complex that it cannot be properly understood, and so full of human failings that it looks man-made.
That would be true if God were any of those things. I can agree with you though that your understanding of God is self-contradictory, alien to your experience, etc. You believe you have God figured out, when you don't know Him at all. You would actually do anything to know God, but you are rejecting Him out of ignorance.
In the scenario between multiple universes or God as a theory to describe a finely tuned Universe, God wins every time. It doesn't matter how complex God might be; the explanatory power afforded by the theory is by far superior.
I’m sceptical of all your claims because that’s how I roll. I’m sceptical of everything, especially big claims. It’s the smartest way to avoid being duped.
You're skeptical of everything that doesn't agree with your presuppositions about reality. Those I have rarely if ever seen you seriously question in all the time I have spoken to you. Regarding knowledge that agrees with those presuppositions, you feel free to speculate about that all day long and will say that virtually any of it is more plausible with no evidence. The thing is, I used to be on your side of the fence, and I know what a search for the truth looks like. This isn't it.
The smartest way to avoid being duped is to understand that you might be duped at this moment and not realize it. That's the trouble with being deceived; you think you're right when you are really wrong.
You have been telling me that I must believe in the one true thing that is true that is Yahweh and the Bible and creation because it’s true because it’s true because it’s true because it’s the only possibility.
What I've been telling you is that God is not hiding from you. You are hiding from Him. It's not that you don't know there is a God so much as you don't want to know that there is. You simply want to do whatever you think is right and you automatically reject any possibility that says this is wrong and you are in fact accountable to a higher authority. In short, your attitude towards God is not skeptical but rebellious.
Now, I conceive of another possibility: my 10^trillion universes. You agree it’s possible, so there’s no reason for me to believe yours is necessarily true. If I have to choose between them, the one that doesn’t require the further explanation of a sentient deity more complex than 10^trillion universes is simpler. And even then, I DON’T HAVE TO CHOOSE one or the other. I can remain sceptical. To me, it’s foolish not to.
I concede its possible that God could have created other Universes, but I don't concede the idea that Universes just happen by themselves. This is really a very foolish idea. It's like coming across a coke can and believing wind and erosion created it. It only seems plausible to you because you must have a naturalistic explanation for your existence to make sense of your reality.
I don't expect you to believe in God unless He gives you some kind of revelation. I frequently pray that you will receive this revelation, both for you and the sake of your family.
Since I already pointed out this flawed understand of the law of parsimony, I won't reiterate that argument here.
While we’re talking about being honest with ourselves, I’d like to hear it from you that the following things are *at least technically possible*: that Yahweh doesn’t exist; that your relationship with Yahweh is an illusion created by you inside your head because you are human and human minds are prone to occasional spectacular mistakes; that the Bible was created by deluded humans; that the universe is around 14 billion years old; that the Earth is around 4.5 billion years old; that life on Earth started 1-2 billion years ago; and that all species evolved from primitive life forms. To be clear, I’m not asking you to accept them as true or even probable, just state whether this collection of statements is possible or impossible.
This is what Paul said:
1 Corinthians 15:17,19
And if Christ has not been raised, your faith is futile; you are still in your sins.
If in Christ we have hope in this life only, we are of all people most to be pitied.
I wasn't there at the resurrection; I take it on faith. My faith has been borne out by the evidence, such as being born again, witnessing miracles, and experiencing the presence of God in my daily life. I don't admit any of those things; I have most definitely received revelation from God, and there is no other plausible explanation for the evidence. If you can concede that God can give you certain knowledge then you can understand why I don't doubt that knowledge.
Notice what George Wald said?
I notice that you only quote scientists out of context, or when they’re speaking poetically. I guarantee he never said that in a scientific paper. Life may be a wonder, not a miracle.
I *only* do? That's a false generalization. This quote is right on target, and I challenge you to show me where I have taken George out of context. This is what scientists believe, that time + chance makes just about anything possible. Has life ever been observed coming entirely from non living matter? That's a miracle, and that's what you must believe happened either here or somewhere in the Universe.
http://www.pbs.org/wgbh/nova/physics/blog/2012/03/is-the-universe-fine-tuned-for-life/
Near the end, you’ll find this gem: “The history of physics has had that a lot, … Certain quantities have seemed inexplicable and fine-tuned, and once we understand them, they don’t seem to [be] so fine-tuned. We have to have some historical perspective.”
If you haven't done so already, watch the first 10-20 minutes of this: http://videosift.com/video/The-God-of-the-Gaps-Neil-deGrasse-Tyson. It's "creationism/intelligent design" laid bare as a position of weakness. Your "fine tuning" trope is part of "intelligent design" and has the same historical flaw.
It's the God of the gaps argument which is flawed. It's not a God of the gaps argument when the theory is a better explanation for the evidence.
It's just a bare fact that there is a number of physical constants in an extremely narrow range which conspire to create a life permitting Universe. It's even admitted on the wikipedia page:
Physicist Paul Davies has asserted that "There is now broad agreement among physicists and cosmologists that the Universe is in several respects ‘fine-tuned' for life".[2] However he continues "...the conclusion is not so much that the Universe is fine-tuned for life; rather it is fine-tuned for the building blocks and environments that life requires
http://en.wikipedia.org/wiki/Fine-tuned_Universe
What do you mean, “they hate that possibility”? Why should a scientist hate any possibility? If there were science that pointed to the real existence of God, that’s exactly the way their investigations would go. That’s what motivated early modern scientists – they believed unravelling the laws of the universe by experiment would reveal God’s nature. It was only when the scientific path of experimentation split conclusively away from the biblical account that anybody considered that religious faith and scientific endeavour might become separate enterprises.
The roost of the scientific establishment today is ruled by atheistic naturalists, and they very much hate the idea of God polluting their purely naturalistic theories. They consider science to be liberated from religion and they vigorously patrol the borders, expelling anyone who dares to question the established paradigm. A biologist today who questions the fundamentals of evolutionary theory commits professional suicide. It is now conventional wisdom and you either have to get with the program or be completely shut out of the community.
Here are some other interesting quotes for you:
Richard Lewontin “does acknowledge that scientists inescapably rely on ‘rhetorical’ proofs (authority, tradition) for most of what they care about; they depend on theoretical assumptions unprovable by hard science, and their promises are often absurdly overblown … Only the most simple-minded and philosophically naive scientist, of whom there are many, thinks that science is characterized entirely by hard inference and mathematical proofs based on indisputable data
Astrophysicist George F. R. Ellis explains: "People need to be aware that there is a range of models that could explain the observations….For instance, I can construct you a spherically symmetrical universe with Earth at its center, and you cannot disprove it based on observations….You can only exclude it on philosophical grounds. In my view there is absolutely nothing wrong in that. What I want to bring into the open is the fact that we are using philosophical criteria in choosing our models. A lot of cosmology tries to hide that.
As for the “much” stronger evidence, as stated in the article, every time scientists solve a mystery of something they thought was “finely tuned”, they realized that there is a much simpler explanation than God. Evolution, for instance, eliminates the question of "fine tuning" in life. “God” is a metaphor for “things outside my understanding”. Once they move within our understanding, nobody claims that they’re God anymore. And FWIW, some of the most famous scientists ever came to the same "Because God" conclusion, which held until someone else got past it and solved what they couldn't.
I'm glad you understand that the whole enterprise of science was initially driven by the Christian idea that God created an orderly Universe based on laws, and thus we could reason out what was going on by investigating secondary causes. Yet God wasn't a metaphor for something we didn't understand; God was the reason we were interested in trying to understand in the first place, or even thought that we could.
You say there is this "because God" brick wall that we break down by determining the operations of the Universe. We can then see that it was never God at all, but X Y Z, yet what does that prove? Genesis 1 says "God created", and that He controls everything. What you're confusing is mechanism with agency. Can you rule out a clockmaker by explaining how the clock works? That's exactly what you're saying here, and it is an invalid argument.
You also act as if evolution has been indisputably proven. Let me ask you this question, since you claim to understand science so well. What is the proof and evidence that evolution is a fact? Be specific. What clinches it?
So to your conclusion, how do you figure that the appearance of fine tuning—which seems to go away when you look close enough—is stronger evidence?
It only goes away when you come to a series of false conclusions as you have above. The evidence is there, even the scientists admit it. To avoid the conclusion multiple universes are postulated. However, this is even more implausible for this reason; the multiple universe generator would be even more fine tuned than this Universe. Therefore, you are pointing right back at a fine tuner once more.
Eh??? But in your last nine paragraphs, YOU yourself, a limited temporal creature, have been trying to prove God’s existence with your “fine tuning” argument (corrupt reasoning, like you say), even after you've repeatedly asserted in the other threads that the only possible evidence for God is that he’ll answer our prayers. Why are you bothering? It is laughable how inconsistent you’re being here.
I wouldn't know the truth on my own; only God can reveal what the truth is. There are two routes to the truth. One is that you're omnipotent. Another is that an omnipotent being tells you what the truth is. Can you think of any others?
Keep fishing. Either the patient being prayed for recovers or doesn't recover. If not, the sincere prayers weren't answered. Unless you’re suggesting God secretly removed the free will of the scientists and the people praying so that the tests would come back negative? Gimme a break.
You seem to believe that free will means God doesn't interfere in the Creation, and this isn't the case. Free will means, you have the choice to obey or disobey God. It doesn't mean you are free from Gods influences. That's the whole idea of prayer, that God is going to exert His influence on creation to change something. God is directly involved in the affairs of men, He sets up Kingdoms, He takes them away. He put you where He wanted you and He will take you out when He has sovereignly planned to do it.
Even if the prayers are sincere, God isn't going to heal everyone. Yes, either way the patient recovers or doesn't recover, and either way, God isn't going to reveal His existence outside of what He has ordained; faith in His Son Jesus Christ. Anyone trying to prove Gods existence any other way will always come away disappointed.
And all of this was written only after the prophesy was fulfilled. A little too convenient.
Actually it was written hundreds of years before hand.
The 70 weeks are not concurrent, first of all.
I know. I'm assuming they were consecutive. How could 70 weeks be concurrent? That makes no sense at all. Even if you meant to say “not consecutive”, what does it mean to declare a time limit of 70 weeks if they're not consecutive? It means nothing. That time limit could extend to today. What's your source for saying they're not concurrent/consecutive/whatever?
This is why I suggested you become more familiar with theology. Yes, you're right, I meant to say consecutive. You would know they were not consecutive if you read the scripture. The prophecy identifies they are not consecutive. Please see this:
http://www.khouse.org/articles/2004/552/
Again, conveniently, this “prediction” doesn't appear in writing until after the fall of Jerusalem.
Jerusalem fell in 70 AD. The gospels were written beforehand. If they were written afterwards, there would have been a mention of the fall of the city, if only to confirm the prophecy, but there is no mention of it in any of the gospels.
I'll rephrase this by saying, that Jesus fulfilled dozens of prophecies about the coming of the Messiah. Clearly, the impact of that Jesus has had on the world matches His claims about who He is.
Which clearly defined prophecies did he fulfil, not including ones that he knew about and could choose to do (like riding on a donkey)?
http://www.godonthe.net/evidence/messiah.htm
Except for all the religions that aren't Christian. They don’t belong to him, and they have surely had enough time to hear his voice.
The world belongs to Christ. The difference between the Lord and the other religions is this:
1 Chronicles 16:26
For all the gods of the nations are idols, but the LORD made the heavens
You really think that’s unique to Christianity? Do you know much about Islam? And I don't mean Western stereotypes of it. I mean, really know how normal Muslim people live their lives.
Muslims don't have a personal relationship with God. Allah keeps them at arms length, and they mostly serve him out of fear. They also have no idea whether they are going to heaven or not. They only hope that at the end of time their good works will add up more than their bad ones. The reason Muslims choose martyrdom is because under Islam it is the only guaranteed way to go to Heaven.
I get it. It’s a test of sincerity. For whom? Who is going to read and understand the results? To whom is the sincerity proven that didn't know it before, requiring a test? I think you’re avoiding admitting it’s God because that would mean there’s something God doesn't know.
Why do metalworkers purify gold? To remove the dross. That's exactly what God is doing when He tests us:
1 Peter 1:6
In this you greatly rejoice, though now for a little while you may have had to suffer grief in all kinds of trials.
These have come so that your faith--of greater worth than gold, which perishes even though refined by fire--may be proved genuine and may result in praise, glory and honor when Jesus Christ is revealed.
>> ^messenger:
stuff
Richard Feynman on God
Similarly, we can instantiate in enough physical rules to get the "chance" universe you describe going, and its rules could get it to the current state either determinalistically or with some element of randomness. I guess I understand how you're using "chance" here... but I don't know that it's terribly useful. Why should "what humans can predict" be of any relevance philosophically? And if we're using it that way, couldn't we similarly describe God's actions as chance? I mean, surely humans (or angels) can't predict everything he's going to do. Chance seems like a pejorative when applied to God.. and to me it seems like a pejorative when applied to the operations of the universe (except where, again, that operation is actually random).
However, again, I don't think this difference is terribly important. I think I understand what you're getting at, I just see things very differently.
The difference between chance and design is the most important distinction there is. If you don't like the word chance, I will use the word "unplanned", or "mindless". An unplanned Universe has no actual purpose; it is just happenstance. Meaning, your life is just a product of mindless processes, and concepts like morality, justice, and truth have no essential meaning. It means you are just some blip on a grid and there is no rhyme or reason to anything. It also means you will never find out what happened or why it happened because no one knows what is going on or ever will. This will *always* lead you to nihilism.
A designed Universe, on the other hand, does have a purpose. A purposeful Universe means that life was created for a reason. It means that there is a truth, a truth that only the Creator knows. Which means that all lines of inquiry will lead to the Creators doorstep, and that trying to understand the Universe without the Creator is completely futile. It is like looking at a painting with three marks on it..you could endlessly speculate on what the painter was thinking when he painted it. However, no matter how clever you were, you don't have enough information to be sure about anything. To refuse to seek the Creator would be to stare at that painting your whole life trying to figure it out when you have the painters business card with his phone number on it in your pocket.
I don't think you're phrasing this in a terribly fair way. Yes, many people assume there's a natural explanation for abiogenesis. This is partly because having another explanation introduces arbitrariness into the system. Say I'm a geologist and I discover Devil's Tower. It's really weird, but my inclination from the very start is that it was formed by similar processes to ones that have explained weird things in the past. Even if I can't postulate even a guess as to why it has those weird columns, I'm not crazy to guess that eventually we'll figure out an explanation that doesn't involve, say, new physical laws or aliens. (And it's certainly not helpful to say "maybe it was made in the flood").
The whole thing is arbitrary to begin with. Naturalistic explanations are assumed apriori, and then the evidence is interpreted through the conclusion. That isn't how science works. You come to the conclusion because of the evidence, not the other way around. I would also note that you would never accept this kind of reasoning from a creationist. Neither does a mountain of circumstantial evidence prove anything.
Abiogenesis is a bigger problem and it's also one that's "lost to time" a bit. It almost certainly requires a mechanism we have yet to identify (or a mechanism someone has guessed at, but hasn't provided good details or evidence for). But, like Devil's Tower, there's no reason to expect that mechanism won't be identified - or that it will require significant changes to our understanding of the rest of science. Again, there's plausible ideas already floating around, and I think we'll probably recreate the process (though likely not with the same actual process) within the next 30 years or so.
Anything sounds plausible, apparently, when you have billions of years to play with. As the earlier quote said, time itself performs the miracles for you. How do you know that the mechanism hasn't already been identified but you have rejected it?
http://creation.com/devils-tower-explained
No... that, I think, is probably our strongest point of disagreement. I'm very much OK with "I don't know", and literally everything I believe has a bit of "I don't know" attached (kind of similar to how everything you believe in has a bit of God attached).
I'm not worshipping ignorance or something - knowing IS better than not knowing. But I'm also not scared of not knowing things - and I'm certainly not just going to pick something and believe in it because I don't like having some of my answer pages blank.
For you, is Scientology better than "I don't know"?
The point I'm trying to make is, I don't know isn't a theory. What most atheists mean when they say "I don't know" is "I know it isn't the Christian God, but otherwise I don't know". The next thing they say is, you believe in God because you're afraid. That I "chose" God because I am scared of death, or because the Universe is too big and scary for my mind to handle the uncertainty of not knowing.
I have to say that this idea of a bunch of hokey. The Christians I know believe in God because they have a personal relationship with Him. It has nothing to do with making a choice..God chose us. He would chose you too, if you were open to Him.
Neither was I afraid of death when I was an agnostic, and I wasn't afraid of saying I don't know (that's why I was an agnostic, because I didn't know). I believe in God because He revealed Himself to me, and that is the only reason. If He hadn't, I would still be an agnostic.
It is credible to believe that the Universe was designed and created by God. We can see that whomever made the Universe is unimaginably powerful, intelligent, exists outside of space and time, etc. Scientology isn't credible and explains nothing. God can explain everything.
Also, thanks for using the big boy version of the Bible. I quite like the Bible artistically, but I can't stand some of the new translations (despite whatever benefits some parts may have in terms of clarity).
Most of the new translations butcher the scriptures. They remove entire verses, words, water down meanings, or just flat out mislead. I can't stand them either. The KJV is the best word for word translation that we have, and although the language is archaic, it is comprehensible with a little research.
>> ^jmzero
Richard Feynman on God
If we can boil all of the possibilities down to design and chance, how could you tell which Universe you were in?
I kind of abandoned this part because I don't think our differences on this matter are terribly interesting. But I'll come back to it for a second to clarify. To me, there is no important difference between these two things you're talking about.
I don't see myself as terribly different than a falling rock. While it's useful in many situations to think of myself as designing something, in absolute terms me building a house is no different than water eroding through a rock - they're just things that happen following from the state and rules of the universe. What you're calling "design" and "chance" are both, to me, just parts of "the rules for moving from one state to another" and I don't see a big philosophical difference between them (I also don't think there's any important philosophical reality to "free will", if that helps you understand my position).
If we have a start state with a certain kind of benevolent God, the rest of the stuff flows from that through state change rules of some sort - and I don't find it terribly interesting what sorts of rules and processes are involved to get from that start state to the current one (or, at least, only to the extent that those rules and processes may imply more or less arbitrariness in the start state).
Similarly, we can instantiate in enough physical rules to get the "chance" universe you describe going, and its rules could get it to the current state either determinalistically or with some element of randomness. I guess I understand how you're using "chance" here... but I don't know that it's terribly useful. Why should "what humans can predict" be of any relevance philosophically? And if we're using it that way, couldn't we similarly describe God's actions as chance? I mean, surely humans (or angels) can't predict everything he's going to do. Chance seems like a pejorative when applied to God.. and to me it seems like a pejorative when applied to the operations of the universe (except where, again, that operation is actually random).
However, again, I don't think this difference is terribly important. I think I understand what you're getting at, I just see things very differently.
Yet, it is assumed to be true because "there must be a naturalistic origin to life".
I don't think you're phrasing this in a terribly fair way. Yes, many people assume there's a natural explanation for abiogenesis. This is partly because having another explanation introduces arbitrariness into the system. Say I'm a geologist and I discover Devil's Tower. It's really weird, but my inclination from the very start is that it was formed by similar processes to ones that have explained weird things in the past. Even if I can't postulate even a guess as to why it has those weird columns, I'm not crazy to guess that eventually we'll figure out an explanation that doesn't involve, say, new physical laws or aliens. (And it's certainly not helpful to say "maybe it was made in the flood").
Abiogenesis is a bigger problem and it's also one that's "lost to time" a bit. It almost certainly requires a mechanism we have yet to identify (or a mechanism someone has guessed at, but hasn't provided good details or evidence for). But, like Devil's Tower, there's no reason to expect that mechanism won't be identified - or that it will require significant changes to our understanding of the rest of science. Again, there's plausible ideas already floating around, and I think we'll probably recreate the process (though likely not with the same actual process) within the next 30 years or so.
I think you'll have to admit that God is a much better theory than "I don't know".
No... that, I think, is probably our strongest point of disagreement. I'm very much OK with "I don't know", and literally everything I believe has a bit of "I don't know" attached (kind of similar to how everything you believe in has a bit of God attached).
I'm not worshipping ignorance or something - knowing IS better than not knowing. But I'm also not scared of not knowing things - and I'm certainly not just going to pick something and believe in it because I don't like having some of my answer pages blank.
For you, is Scientology better than "I don't know"?
Edit:
But without faith it is impossible to please him: for he that cometh to God must believe that he is, and that he is a rewarder of them that diligently seek him.
Also, thanks for using the big boy version of the Bible. I quite like the Bible artistically, but I can't stand some of the new translations (despite whatever benefits some parts may have in terms of clarity).
Richard Feynman on God
Fair enough - it sounds like you're certain in every practical sense, but you don't believe you have "absolute knowledge". That was really the main distinction I was trying to make. Certainly I agree that you can't reason in any meaningful way without writing off certain kinds of extreme possibilities.
I think absolute knowledge is possible even from our subjective standpoint. For instance, it is absolutely true that "something" exists. Any argument against this is actually proof that it is true.
In any case, I am making a claim to absolute knowledge, because divine revelation could only ever be absolute knowledge. A person receiving such revelation would have a justified true belief in God. That's my claim. It's not something I could prove..only God could prove it, but neither am I unjustified in believing it.
I understand the contrast here, and I think I understand now what you're trying to get at better - I just don't think this contrast is fundamental to the question I'm interested in (which is different, I think, than the one you're interested in). To me the intermediary steps are fungible - it's the start states that are interesting to me, and to me they all require arbitrary stuff that I don't like, but that seem necessary.
Well, originally you were responding to this question:
"I'll ask you the same question I ask messenger..how would you tell the difference between a random chance Universe and one that God designed? What test could you conduct to find out which one you were in? When you can come up with a test to determine that, then you can tell me that there is no evidence. Logically, if there is a God, the entire Universe is evidence."
If we can boil all of the possibilities down to design and chance, how could you tell which Universe you were in? What test could you conduct that would tell you the difference? Atheists often demand some kind of empirical proof of God, yet they are never forthcoming on the details of what that proof would consist of. That is really the impetus behind this question..
I think this difference in focus may come down to our varying perceptions of those intermediary steps. For me, the general big bang model, ideas of how stars and planets coalesced, natural abiogenesis, and evolution are reasonably credible as they stand and I expect those theories to develop and become more credible. You see those things very differently. I think that naturally leads to a different focus.
The reason I don't see them as credible is because of a lack of evidence. For instance, there is absolutely no evidence of abiogenesis, at all. In fact, louis pasteur proved that it is most likely impossible. Life has never once been observed coming from non-life. Yet, it is assumed to be true because "there must be a naturalistic origin to life". It's a just-so story and it isn't at all credible. I've heard the odds of it happening are far greater than the number of atoms in the Universe.
People tell me that Creation sounds like a fairy tale, but then they tell me their own story that begins with "once upon a time a frog became a prince", and this somehow sounds plausible when you throw in billions of years.
time is in fact the hero of the plot. the impossible becomes possible..time itself performs the miracles.
George Wald
Harvard
Nobel laureate
I agree with this as well - to an extent. Having a unique God makes for a simple explanation in general (although it gets a bit complicated in practice for how we ended up precisely "here"). For the general problem of "how did this all get here", your recipe is very simple if it starts with God. On the flip side, God is a very big thing to assume. I think a case can be made for belief in a general God on something like this basis. Though I don't personally find it a convincing case at this time, that could change.
I think you'll have to admit that God is a much better theory than "I don't know". Yet, people bandy about "I don't know" as if this is the superior position. You have to wonder why to even think that the Universe was designed is subject to so much ridicule and derision, when it is actually a perfectly reasonable theory that is supported by evidence. As far as assuming God goes, you don't need to explain God to postulate Him as a possibility. What matters is whether the idea has explanatory power. The question always is, is God a better explanation for the evidence?
It isn't always an evidential argument, either. There many logical arguments to assume there is a God:
http://www.peterkreeft.com/topics/first-cause.htm
Perhaps another question: for you personally, would you describe your situation as more like "God provided me with special evidence, and I reason that He must exist because of this evidence" or more like "God produced a change in me directly, such that I now believe (unmediated by your own reason)"? (Or, obviously, something in between or different altogether). I think this would clarify your situation for me.
I received evidence in a number of different ways. One, is that God fundamentally changed me. In the blink of an eye, where I was broken, I was now healed. Where there was addiction, there was self-control. Where there was hate, there was now love and forgiveness. Where there was darkness, there was now light. It was instantaneous and it certainty had nothing to do with me. I would have stayed the way I was, left to my own devices. It was a supernatural transformation of my inner being.
Another thing is that God has demonstrated to me, beyond all reasonable doubt, that He is in absolute control of everything. To the extent that I no longer include the word coincidence in my vocabulary. In short, He has used my internal and external experiences to give me evidence of His existence, and this is ongoing. I always experience the presence of God because His Spirit lives within me.
There are other ways that I cannot quite put into words. The peace of God transcends all understanding. His love surpasses all expectation and every height; it is a deep and wondrous mystery. He is my Father, and I am his (adopted) son. My relationship with God is a personal one that has changed my entire life in every conceivable way, beyond anything I could ever imagine or hope for.
>> ^jmzero
Richard Feynman on God
I think we have to take certain things for granted because not everything can be proven empirically. There is no way to empirically prove that the Universe is actually real. To say that it is real you have to rely on your senses and reasoning. You can't say those are valid without using viciously circular logic. "My reasoning is valid because my reasoning says so" Without assuming certain things, apriori, the world would be unintelligable. Neither could you do science. To do science you have to assume the uniformity in the nature. How do you prove it? By assuming the future will be like the past. What is the evidence that the future will be like the past? The past. It's the same vicious circularity.
As far as Gods existence goes, I never assumed either way. I knew I didn't have enough information to say either way, so I was agnostic by default. I only changed my mind when I received evidence. I wasn't under any pressure to do so, nor was I even looking to do so.
So, while science has a pitiless indifference to how you feel in regards to what is true, it is not the sole arbitor of what is true. This idea that empiricism is the only way to determine truth cannot be proven empirically, ironically. It is an assumption that materialists make with no actual evidence. The argument seems to be that since we can build a space shuttle, empiricism must the way. Yet, that isn't a logical argument. Empiricism might be useful, but it isn't the only method of inquiry that is useful. Everything has its place, and empiricism has a hard limit to what it can prove.
Yes, there certainly is material out there. Does that we can see and test material means that material causes are the only possible solution? We can't see dark matter, dark energy, other universes, other dimensions, yet scientists have no trouble postulating about what we can't see. So why not postulate that the Universe has a non-material causation? Why not an intelligent causation? I would say the evidence is a lot more convincing for intelligent design than other Universes, yet science only considers one to be plausible. Don't you think that is irrational?
I'll ask you the same question I ask messenger..how would you tell the difference between a random chance Universe and one that God designed? What test could you conduct to find out which one you were in? When you can come up with a test to determine that, then you can tell me that there is no evidence. Logically, if there is a God, the entire Universe is evidence. Isn't it possible that you are staring at something divinely ordered but don't realize it?
>> ^gwiz665:
You make a good point. In our daily life we are certain about a lot of things, or rather we accept things for granted without any thoroughly investigated evidence. We assume that we exist, because that's needed for us to assume it. We assume we have free will, because it feels like we have free will.
I also live as if there is no God, because of the "path of least resistance" - it is easier to assume there is no god, than to assume there is, and since it has no difference to me, the easiest solution is fine. I think for many theists, it least resistance to assume that there is a god, and live as if he exists, be it because of social pressure, mindset or what have you - in any case, their path of least resistance is to assume he exists. If you think about all the shit an outed atheist go through in some states, I can't really blame them for that too much.
It is a different deal when you get into the science of it, because in science we deal with what is real and what is not. The good thing about science is that it doesn't care. It doesn't care about your feelings, it doesn't care that lots of people like a thing, it only exist to show the truth and to show nature for what it really is.
Materialism is absolute in that it's really there, like Feynman says so excellent in his video about the electro-magnetic spectrum. It may not have much of an effect in your everyday life how light moves in waves and how it's similar to how water makes waves, but that doesn't make it any less true. You can assume that they are unrelated if you want, and if that makes you sleep better at night, but it's just not how nature works.
If you take the issue of God under the microscope, you find that there's not much evidence backing it up when you really look. The social pressure is there, and the cultural ramifications are there, but there's no evidence backing up the actual existence. The hypothesis "it was all made up" has equal merit, because you can find just as many traces of this than you can of it actually being real.
Fact or Friction
>> ^Trancecoach:
It's a nice use of rhetoric, @NetRunner, but my use of the word if in this case was not to postulate that the stem of the sentence (A) is or could be untrue. I'm using a more syllogistic style suggesting that given that the stem (A) is true, then why not B?
Logic, not rhetoric. There's a difference.
The way I see that argument is as an attempt to prove A is false by contradiction. The way that works is you start with the assumption that your conclusion is false (what if A were true...), and then based on that assumption try to reach a conclusion that's impossible (why would anyone hire men if women are willing to do the same job for less?).
>> ^Trancecoach:
And my response to that, again, (and let me make this clear, because you seem to think that we're in disagreement on this point) is to accept that there is, in fact, a wage disparity on the basis of gender. What I am suggesting, which I believe Rachel doesn't appreciate in this clip, is that there are other, deeper, societal reasons underlying this wage disparity and, thus, there are other, deeper, societal ways to address these reasons which do not include legislation in the manner in which it's being proposed.
Actually I think we're talking about separate propositions. When I say "Women get paid less for equal work", I'm talking about the intersection of these two sets of women:
PL = Women who get paid less than men
EW = Women who provide equal work (i.e. is as productive as a man who works in the same industry, with the same job title, education, experience, hours, etc.)
So what I'm talking about in proposition A is the intersection of PL and EW. In other words women who are being paid less than men for doing the same job. As far as I can tell, you seem to accept the existence of PL, but deny that both PL and EW are happening simultaneously to any significant degree.
In other words, you don't dispute that women are being paid less as a group, you just believe that this is because women as a group aren't doing equal work. They stay at home to raise children, don't pursue advanced degrees, or maybe they just weren't raised to be as outspoken/competitive/aggressive as men. Whatever the cause, you posit that it is this deficit in quality or quantity of work from women which is the primary reason women get paid less than men on average.
That's not a basic agreement with A, that's a wholly different assertion.
>> ^Trancecoach:
While I do not side with conservatives or corporatists on this issue (because I do not deny that the wage disparity exists nor do believe that it's the way it should or ought to be), I do believe there are other underlying factors which include both misogyny and misandry that have fostered the problem to its current state.
That's good, but as I said above, the "other factors" you've presented so far are to suggest that the members of PL are not members of EW. You're suggesting women aren't providing equal work, and this at least partly explains pay disparity.
And yes, I get that you're saying it in a soft, non-accusatory tone -- it's not that women are intrinsically inferior, it's that our society as a whole is shaping them into less valuable workers, whether they want that or not.
Still, I think anytime you go around saying pay discrimination is in any sense justified, you're wading into some dangerously misogynistic waters. Worse, I think if you use the word "myth" to describe the idea that women face unjust pay discrimination, you've pretty much jumped in with both feet.
Fact or Friction
It's a nice use of rhetoric, @NetRunner, but my use of the word if in this case was not to postulate that the stem of the sentence (A) is or could be untrue. I'm using a more syllogistic style suggesting that given that the stem (A) is true, then why not B? And my response to that, again, (and let me make this clear, because you seem to think that we're in disagreement on this point) is to accept that there is, in fact, a wage disparity on the basis of gender. What I am suggesting, which I believe Rachel doesn't appreciate in this clip, is that there are other, deeper, societal reasons underlying this wage disparity and, thus, there are other, deeper, societal ways to address these reasons which do not include legislation in the manner in which it's being proposed. (Perhaps legislating on the issue would be, as you say, "harmful to society," but it seems that it would likely be ineffectual with regards to addressing what's at cause of the problem -- which, as I consider it now, tends to be the case with most governmental legislation.)
Farrell does offer some explanations for the wage disparity and, like me, feels it's unacceptable, morally. We (You, Rachel, Warren, and myself) could all, essentially, cite the very same statistics and studies and draw different interpretations and conclusions from the data which clearly demonstrates the disparity in wages on the basis of gender. While I do not side with conservatives or corporatists on this issue (because I do not deny that the wage disparity exists nor do believe that it's the way it should or ought to be), I do believe there are other underlying factors which include both misogyny and misandry that have fostered the problem to its current state.
Richard Dawkins and Lawrence Krauss: Something from Nothing
The point of this video, and Dr Krauss's book, is to explain how "something came from nothing". The question of how something came from nothing is a philosophical question, the very deepest question actually, which is intended to address a specific problem, namely why is there a Universe in the first place? Why is there something rather than nothing? What it boils down to is, that unless there is an eternal first cause, all existence at some point had an absolute beginning from absolutely nothing. This of course is impossible; an eternal first cause is the only plausible answer, but scientists and many philosophers have a big problem with an eternal first cause; namely that it opens the door to a Creator. Therefore, no matter that all of the evidence points to time, space matter and energy having an absolute beginning, or the absurdity in trying to prove something came from nothing, they stubbornly refuse to accept this conclusion, because it is incompatible with their philosophical predispositions.
The purpose of Dr Krauss's book is, in his words, to "make it plausible to consider God as unnecessary". He attempts to do this by demonstrating that something can come from nothing after all. Yet, that isn't what he accomplishes in the book. What has done is claim that the concept of nothing is a scientific problem, and then redefine the meaning of the word to a nonstandard definition. Under his new definition, nothing is empty space, or a quantum vacuum. In his words, "nothing is unstable". What he has done is make "nothing" into "something", that something being the laws of quantum mechanics. When pressed as to where those laws come from, he postulates a multiverse. He provides no explanation as to the origin of the multiverse. In short, he has not solved the original problem, and therefore has not "made it plausible to consider God as unnecessary". He has simply shown that, when the laws of quantum mechanics are operating, strange things can happen. Laws are "something", and a multiverse to explain those laws is "something", so therefore, he has not answered the question of how something came from nothing.