search results matching tag: slam dunk
» channel: motorsports
go advanced with your query
Search took 0.000 seconds
Videos (35) | Sift Talk (2) | Blogs (2) | Comments (82) |
Videos (35) | Sift Talk (2) | Blogs (2) | Comments (82) |
Not yet a member? No problem!
Sign-up just takes a second.
Forgot your password?
Recover it now.
Already signed up?
Log in now.
Forgot your password?
Recover it now.
Not yet a member? No problem!
Sign-up just takes a second.
Remember your password?
Log in now.
Creationist Senator Can E. Coli Turn Into a Person?
It is absurd, but it is also evidently, and provably true. It is a fact. Back in the days of Darwin one could perhaps make the case that the idea of common descent was perhaps stretching it far, but the discovery and later sequencing of DNA makes it a slam dunk. There is no other even remotely reasonable conclusion you can make, but the one that says you are related to a tomato. and elephants, and chimps, and E.Coli and shrimps and everything else that has DNA. Not only do we all share the same basic system (why doesn't some species use different nucleic acids or something else to replicate?) But we share the SAME CODE. Even with our most distant cousins (something like E.Coli) have long strands of DNA code in common with us. The four nucleic acids of DNA , represented by the letters A,T,C and G are laid down by the thousands in patterns like: AAAATTCGGGTATTTATTTGCAAACCTTTT, and then we find the SAME CODE in completely "unrelated" species. But thats not all, the relatedness of the code is excactly what you would expect in the taxonomic tree, and infact it is now THE method for figuring out exactly how related one species is to another, and drawing the correct tree.
So all life IS related, which means it all has a common ancestor, which lived some 3 billion years ago. Which also means it had to be a simple form that diverged into all that we now have. And that process is evolution, and the main driving forceof evolution, by far, is natural selection. So we know that this process happens and that it can create amazing things from really much simpler things. All we need to postulate is the capability to self-replicate for those first replicators. Admittedly, this is pretty hard to envision, but we do know that all the basic building blocks (organic molecules) could arise spontaneously through non-replication. But we may never know exactly how it started, it would be something simple, like some organic molecules spontaneously forming RNA strands, which break in two and each half collects its counter-parts and form two RNA strands and so on...
Evolution is real. However to imply or believe that all things evolved from the utter basic building blocks to what we have today is absurd.
Another compilation of awesome people doing awesome things
The music was spot on!!
)
Agree that several of the slam dunks were less impressive than the rest, but that is details in a fantastic *win compilation! (Or * ftw, as they call it nowadays..
Another compilation of awesome people doing awesome things
The wing suit clips and ski-gliding clips were insane.
The slam dunks were not so impressive.
Inside a Scientology Marriage
>> ^messenger:
Buddhism is a religion. A religion doesn't have to have gods. Perhaps what you mean is Buddhism isn't a religion that requires total control. Jainism is another example of a religion without gods.
I didn't make clear my point about laws, etc. and control: I'm reading into your comments that anything that is about control is always a bad thing, or is always for nefarious purposes. I got this impression because you ended your argument with the conclusion that religions are all about control, as if that was a slam-dunk making them all cults. I pointed out a series of other instances where requiring control over a person wasn't evil, and was even benevolent. This should lead to the conclusion that a religion that asserts control over someone's life may be doing so with good intent. I also did this to highlight the difference between "control" and "excessive control" which you left out. Parental control is normally a good thing. Excessive parental control is a bad thing. Where's the line between control and excessive control? Dunno.
I think you overstated your challenge to me, as there is no religion that requires the relinquishing of free will. They either require or suggest self-control in certain areas, if that's what you mean, but none require relinquishing all decision-making, not even the extreme ones like Jainism, orthodox Judaism, or fundamentalist Islam.>> ^A10anis:
Buddhism is not a religion in the context of this discussion. Neither is the law etc! That said, I will gladly concede, if you can name me a religion/cult which does not require total submission and the relinquishing of free will. I'm done...>> ^messenger:
All faiths do not have the same agenda. That's a ridiculous statement, even if you restrict it to long-established religions. For example, Buddhism seeks to help you find the best person you can be for its own sake, not for the service of some higher power. That's not excessive, and equating it with Scientology in terms of degree of control is not accurate. As for control, yes, all systems --both religious and secular-- involve control. This includes laws, government systems, psychotherapy and parenting. You left out the word "excessive". It's important. Cults are perceived to have excessive control. What constitutes excessive is a matter of debate or personal opinion, but tarring them all with the same brush is still simplistic.
You are a moron, fond only of the nonsense you spout.You have nothing of intellect to convey, so be quiet and know your place...
Inside a Scientology Marriage
Buddhism is a religion. A religion doesn't have to have gods. Perhaps what you mean is Buddhism isn't a religion that requires total control. Jainism is another example of a religion without gods.
I didn't make clear my point about laws, etc. and control: I'm reading into your comments that anything that is about control is always a bad thing, or is always for nefarious purposes. I got this impression because you ended your argument with the conclusion that religions are all about control, as if that was a slam-dunk making them all cults. I pointed out a series of other instances where requiring control over a person wasn't evil, and was even benevolent. This should lead to the conclusion that a religion that asserts control over someone's life may be doing so with good intent. I also did this to highlight the difference between "control" and "excessive control" which you left out. Parental control is normally a good thing. Excessive parental control is a bad thing. Where's the line between control and excessive control? Dunno.
I think you overstated your challenge to me, as there is no religion that requires the relinquishing of free will. They either require or suggest self-control in certain areas, if that's what you mean, but none require relinquishing all decision-making, not even the extreme ones like Jainism, orthodox Judaism, or fundamentalist Islam.>> ^A10anis:
Buddhism is not a religion in the context of this discussion. Neither is the law etc! That said, I will gladly concede, if you can name me a religion/cult which does not require total submission and the relinquishing of free will. I'm done...>> ^messenger:
All faiths do not have the same agenda. That's a ridiculous statement, even if you restrict it to long-established religions. For example, Buddhism seeks to help you find the best person you can be for its own sake, not for the service of some higher power. That's not excessive, and equating it with Scientology in terms of degree of control is not accurate. As for control, yes, all systems --both religious and secular-- involve control. This includes laws, government systems, psychotherapy and parenting. You left out the word "excessive". It's important. Cults are perceived to have excessive control. What constitutes excessive is a matter of debate or personal opinion, but tarring them all with the same brush is still simplistic.
Colin Powell to Romney:"Come on, think!"
Don't get me wrong I don't think Obama has done a bad job but he really hasn't done a good one either he seems more like a figure head to me he just does whatever his cabinet tells him to do. He always comes across to me as a really good guy who has no idea how to run a country. He has a lot of good ideas but he can't ever seem to implement them.
>> ^MycroftHomlz:
I would also like to see him run. But I don't think Obama has done a bad job.
>> ^Auger8:
I think we really missed out on a great President when Colin Powell decided not to run. That would have been a slam dunk win for him but I respect his decision to concentrate on his family. Still he's a very smart man with a strong military background and a born leader. He would have whipped this country into to shape years ago. He at least would have done a much better job than Obama.
Colin Powell to Romney:"Come on, think!"
I would also like to see him run. But I don't think Obama has done a bad job.
>> ^Auger8:
I think we really missed out on a great President when Colin Powell decided not to run. That would have been a slam dunk win for him but I respect his decision to concentrate on his family. Still he's a very smart man with a strong military background and a born leader. He would have whipped this country into to shape years ago. He at least would have done a much better job than Obama.
Colin Powell to Romney:"Come on, think!"
I think we really missed out on a great President when Colin Powell decided not to run. That would have been a slam dunk win for him but I respect his decision to concentrate on his family. Still he's a very smart man with a strong military background and a born leader. He would have whipped this country into to shape years ago. He at least would have done a much better job than Obama.
Patrice O'Neal - Men and Cheating
You may feel you have a responsibility to spread what you believe to be true. That's all fine and dandy, and I have no problem with that. Going to people who do not agree with you, and have made up their mind, and telling them they're wrong for believing what you cannot prove to be certainly true is again an intolerance and disrespectful view of other people. You do NOT have definitive proof, no matter how much you think you do. You don't. Period. Go ahead and try to convince them. There's nothing immoral about that. It is immoral to claim moral superiority and tell people they don't have valid opinions because they don't share yours.
Do you get why it's wrong for an atheist to berate you for believing in a god when you cannot prove with empirical evidence he definitely exists? It's not right. You know why? Because they can't prove with certainty god doesn't exist either. So, respect each other's beliefs, agree to disagree, and follow the Golden Rule for interacting with others in discussion:
Don't be douchey!
Why is it wrong for you to believe an atheist has no valid viewpoint on spirituality? It's really darn simple. First, you equated spirituality to being right or wrong. Then, you said he had no valid opinion about it. If you're equating spirituality to morality and ethics, then why do most atheists believe in the idea of right vs wrong? They have ethics and morality, and theirs isn't subordinate to yours just because you believe in the existence of God.
Even beyond that, it's absurd. If I don't believe in the role of gov't in our lives, does that render all my opinions about gov't useless and always wrong? Since you're all about religion, does that mean all your thoughts about science are completely invalid? Of course not.
Why are my religious views irrelevant? It's really simple. I'm not debating which of our religions is the correct one. I'm debating how to appropriately discuss religion, morality, and ethics with others. You are not the final arbiter of truth. Neither am I. Neither is messenger. We're all struggling to find more truth. Yours isn't more valid because you're Christian.
You're also not an atheist, yet you seem to know exactly what their beliefs are about morality. Instead of trying to argue your side, here's a totally wild idea - why don't you take a little time and understand where they're coming from before you spout ignorant crap about what they believe? I'm sure you don't appreciate when people spout crap about you that isn't true. IE, why don't you use the Christian Golden Rule?
You can stop spouting your religious views to justify your utter disrespect for others and their beliefs. I didn't read a single word of it. Quite frankly, you're pissing me off, and I would suggest you re-evaluate how you discuss this topic with others using that tone. I'm enlightened enough to not hold your douchebaggery against other devout Christians who are more respectful of others. More often than not, it's not convincing people to see it your way. It's causing an irrational recalcitrance against your views. If you truly are a believer of god and trying to change people's minds to a view like your own, this isn't the way to do it. Jesus didn't act like a petulant 5 year old know it all.
>> ^shinyblurry:
Dude, you can have spiritual insights and be an atheist. But you're also doing what many other religious people do that gives religion a bad name - presume that spirituality is synonymous with morality. It's not the same thing. Most atheists have a code or morality.
A spiritual atheist is a contradiction in terms, although I have actually met some. What insight could someone who is unaware they have a spirit offer? That would be like a blind person commenting on the beauty of a sunset.
Everyone has the internal witness of their own conscience to tell them right from wrong. I never said atheists cannot be moral. However, God has given specific revelation of a moral law that He expects everyone to follow.
I'm not getting into my personal religious beliefs with you. Quite frankly they are irrelevant.
How can we have an intellectually honest conversation about personal religious beliefs if you won't say what yours are?
For the record, you don't have definitive proof an omnipotent being revealed to you the absolute truth. You may believe you do, but you don't. Believe it all you want, strongly believe in it. That doesn't bother me, but you have no definitive proof for certain that God exists, let alone revealed to you the exact truth of his nature, etc. etc. etc.
Yes, it is very arrogant to think you have this knowledge. It's not arrogant of me to say that. You have no slam dunk evidence prove he has revealed this to you, or even if he exists. That's why it's called faith. I feel god has visited me in my lifetime to reveal truth, but I don't dare go around telling people that he most certainly did, and his truth is my beliefs, and therefore I know the truth and anyone who contradicts me is wrong. That's quite frankly repugnant and shows a total disrespect for others and their beliefs that haven't a thing to do with you.
Do you know much about Christianity? I have been commanded by God to preach the gospel and to let people know that Jesus is the way, the truth and the life. That is my responsibility, and one day, we will all stand before Him, and we will have to give account for everything that we have done and said, every idle word. This includes what we did and didn't do. I have trouble understanding how you can know that I interpret the world through Christian theism yet fail to understand why I follow it to its logical conclusion, IE, obeying the will of God.
The gospel is a scandal to people because it convicts them of their sin and reveals the eternal destiny that they face without Jesus Christ. It is also the good news, that God sent His only begotten Son, who through His sacrifice on the cross, paid the price for our sins, and that God will forgive your sins and give you eternal life if you turn from them and trust in Jesus as your Lord and Savior.
I'm sorry but it isn't arrogant to tell someone that they are wrong, when they actually are wrong. In this case, if you saw someone walking into a burning building, would you not warn them not to go in there? That is exactly what I am doing, and whether you believe it is credible or not is not the issue. You're violating your own standard of conduct by telling me I am wrong, which is arrogant by your own definition. Neither can everything be definitively proven. You don't have any definitive proof that there are other minds, or that reality isn't an illusion. You cannot prove either conclusion with empirical evidence. Is it arrogant to say that you exist?
God has specifically said that He has given a general revelation of Himself in the Creation, in the things He has made, to everyone, so that no man has any excuse for not knowing there is a God. That is the revelation you have received. He has also given us a special revelation of Himself in the person of Jesus Christ. When you speak of definitive proof, what you are really talking about is knowing Jesus Christ personally. Well, that is what I am telling you. You can know Him today, if you prayed to Him and asked Him to come into your life as Lord and Savior. That is how He told us to know Him, and God will supply the proof. Your refusal to do that is like trying to find an octopus in the desert, and when you don't find any, declaring that there aren't any. There is only one way to know God, and if you don't go that route, you won't know anything about Him. That is why you believe you can know nothing for certain, because you have been given no certain knowledge about who God is.
>> ^heropsycho:
Patrice O'Neal - Men and Cheating
Dude, you can have spiritual insights and be an atheist. But you're also doing what many other religious people do that gives religion a bad name - presume that spirituality is synonymous with morality. It's not the same thing. Most atheists have a code or morality.
A spiritual atheist is a contradiction in terms, although I have actually met some. What insight could someone who is unaware they have a spirit offer? That would be like a blind person commenting on the beauty of a sunset.
Everyone has the internal witness of their own conscience to tell them right from wrong. I never said atheists cannot be moral. However, God has given specific revelation of a moral law that He expects everyone to follow.
I'm not getting into my personal religious beliefs with you. Quite frankly they are irrelevant.
How can we have an intellectually honest conversation about personal religious beliefs if you won't say what yours are?
For the record, you don't have definitive proof an omnipotent being revealed to you the absolute truth. You may believe you do, but you don't. Believe it all you want, strongly believe in it. That doesn't bother me, but you have no definitive proof for certain that God exists, let alone revealed to you the exact truth of his nature, etc. etc. etc.
Yes, it is very arrogant to think you have this knowledge. It's not arrogant of me to say that. You have no slam dunk evidence prove he has revealed this to you, or even if he exists. That's why it's called faith. I feel god has visited me in my lifetime to reveal truth, but I don't dare go around telling people that he most certainly did, and his truth is my beliefs, and therefore I know the truth and anyone who contradicts me is wrong. That's quite frankly repugnant and shows a total disrespect for others and their beliefs that haven't a thing to do with you.
Do you know much about Christianity? I have been commanded by God to preach the gospel and to let people know that Jesus is the way, the truth and the life. That is my responsibility, and one day, we will all stand before Him, and we will have to give account for everything that we have done and said, every idle word. This includes what we did *and* didn't do. I have trouble understanding how you can know that I interpret the world through Christian theism yet fail to understand why I follow it to its logical conclusion, IE, obeying the will of God.
The gospel is a scandal to people because it convicts them of their sin and reveals the eternal destiny that they face without Jesus Christ. It is also the good news, that God sent His only begotten Son, who through His sacrifice on the cross, paid the price for our sins, and that God will forgive your sins and give you eternal life if you turn from them and trust in Jesus as your Lord and Savior.
I'm sorry but it isn't arrogant to tell someone that they are wrong, when they actually are wrong. In this case, if you saw someone walking into a burning building, would you not warn them not to go in there? That is exactly what I am doing, and whether you believe it is credible or not is not the issue. You're violating your own standard of conduct by telling me I am wrong, which is arrogant by your own definition. Neither can everything be definitively proven. You don't have any definitive proof that there are other minds, or that reality isn't an illusion. You cannot prove either conclusion with empirical evidence. Is it arrogant to say that you exist?
God has specifically said that He has given a general revelation of Himself in the Creation, in the things He has made, to everyone, so that no man has any excuse for not knowing there is a God. That is the revelation you have received. He has also given us a special revelation of Himself in the person of Jesus Christ. When you speak of definitive proof, what you are really talking about is knowing Jesus Christ personally. Well, that is what I am telling you. You can know Him today, if you prayed to Him and asked Him to come into your life as Lord and Savior. That is how He told us to know Him, and God will supply the proof. Your refusal to do that is like trying to find an octopus in the desert, and when you don't find any, declaring that there aren't any. There is only one way to know God, and if you don't go that route, you won't know anything about Him. That is why you believe you can know nothing for certain, because you have been given no certain knowledge about who God is.
>> ^heropsycho:
Patrice O'Neal - Men and Cheating
Dude, you can have spiritual insights and be an atheist. But you're also doing what many other religious people do that gives religion a bad name - presume that spirituality is synonymous with morality. It's not the same thing. Most atheists have a code or morality.
I'm not getting into my personal religious beliefs with you. Quite frankly they are irrelevant.
For the record, you don't have definitive proof an omnipotent being revealed to you the absolute truth. You may believe you do, but you don't. Believe it all you want, strongly believe in it. That doesn't bother me, but you have no definitive proof for certain that God exists, let alone revealed to you the exact truth of his nature, etc. etc. etc.
Yes, it is very arrogant to think you have this knowledge. It's not arrogant of me to say that. You have no slam dunk evidence prove he has revealed this to you, or even if he exists. That's why it's called faith. I feel god has visited me in my lifetime to reveal truth, but I don't dare go around telling people that he most certainly did, and his truth is my beliefs, and therefore I know the truth and anyone who contradicts me is wrong. That's quite frankly repugnant and shows a total disrespect for others and their beliefs that haven't a thing to do with you.
>> ^shinyblurry:
You do not have a monopoly on spirituality or spiritual insight. You assume that your spirituality gives you the complete truth, and you jumped the shark to certainty of your beliefs. I don't have a problem with you believing you're correct. That's sorta why you came to that conclusion. It's the part where you're certain, and deny the mere possibility you could be wrong when debating others, and have the audacity to tell other people they have no spiritual insight.
Messenger is an atheist; by definition he knows nothing about the spirit. Further he explicitly denies that there is any such thing. Even if I wasn't certain about what I believe, what I said would still be factual.
Jesus said He is the way, the truth and the life. He had the audacity not just to say He is right, but that He is truth itself. I believe Him and agree. If I had doubts about who Jesus is, I wouldn't follow Him. A Christian makes an audacious decision; that Jesus is the living God.
That's garbage, and the exact point I was making to Messenger when he assumed your religion was controlling your mind. It's this kind of thing that gives some religious people and atheists who refuse to acknowledge there's a possibility of a god a bad name.
Do you believe there is a God?
It doesn't depend on the question. There's a ton of things loaded into the question. What are you defining as god? Who are you defining as Jesus? What does it mean to be the "Son of God"? Etc. etc. etc. There are different ways to answer those questions, and depending on those answers, it radically changes what the meaning is of a yes or no answer. The different ways you answer it can provide useful insights.
Of course it depends on the question. If I ask, was the Universe created, that has a right answer and a wrong answer. If I ask, what is the Universe, that has many answers. Words have meaning, and if we agree upon those meanings, we can come to a point of fact. If we define God as the Creator of the Universe, and Jesus as the historical person, Jesus of Nazereth, then there clearly is a yes or no answer.
Although it is promising that you believe in absolute truth, you are still trying to make it relative. You are saying there is a truth, but you are also implying that no one can know what it is. If someone did know what it is, would they be arrogant for being certain about it? No. You just seem to believe no one can be certain about it. There are two scenerios in which you could know the truth absolutely: 1. You are an omnipotent being. 2. An omnipotent being reveals the truth to you. I fall under scenerio 2.
And to be honest, these are questions often thrown out there that cause more problems than they help solve. First off, it doesn't necessarily matter if Jesus is truly the son of God or not. Believing it still can provide a useful belief framework to help people make themselves better. Choosing to believe in the principle of "matter can not be created nor destroyed" can provide insights into the world even though we know that's not entirely true.
Regardless, you and your religion are not the final arbiters of spiritual truth. Period. It's conceited to think you are.
It absolutely matters whether Jesus is God because what you believe about Jesus determines where you spend eternity. If Jesus is God, He is the final arbiter of spiritual truth, and it is on His authority as God that I speak that truth. You think it's wrong to be certain of truth, yet absolute truth is exclusive truth. It is simply unreasonable for you to place the limitation of your uncertainty about truth upon others. If God came to you and gave you absolute and undeniable revelation, would you be wishy-washy about whether you believe it or not? Can you admit to yourself that God, if He wanted to, could give absolute revelation of the truth to anyone? If you can admit that, and you know that I believe that He has given such revelation, then you shouldn't be surprised that I claim to know what it is with certainty. That is exactly what you would expect from someone who has encountered the living God.
>> ^heropsycho:
Santorum: Obama a Snob: He Wants Your Kids to go to College
Criticizing any candidate seems a slam dunk...until you remember the marxist clown in the White House RIGHT NOW.
Are you enjoying the higher gas prices, higher food prices? Double digit unemployment? More wasteful and impotent spending? Crony capitalism AND crony socialism? (redundant)
Speaking of kollij, when will His Earness be releasing HIS grades and kollij papers? I mean, he's a GENIUS, riiiiiiight?
7' 5" Tall Player Dominates a High School Basketball Game
was that a "slam dunk?" or more of a "forcefully pushing the ball through the net while standing"
hpqp
(Member Profile)
Good point. I agree.
However, it still cracks me up that Willard sat down at that booth thinking he had a slam dunk photo op and instead with met with diverse America.
In reply to this comment by hpqp:
>> ^bareboards2:
omg, @<a rel="nofollow" href="http://videosift.com/member/hpqp" title="member since July 25th, 2009" class="profilelink">hpqp, come check this out... hysterical!!!
That was actually kinda sad. Ever since Bachmann's pathetic argument against gay marriage I cannot get out of my head that, if these tools are going to cite the first Americans, they should remember that marriage was always - until very recently - between men and women of the same race. I just wish someone would pull that on them in an interview.
The Religious Mind Is Morally Compromised: Demonstration
>> ^hpqp:
So let me paraphrase:
Derp: "Hey herp, stop protecting your kid, I want to torture it, kill its friends and make it hate you for abandoning it."
Herp: "Sure, torture away!"
Million dollar question: is Herp a moral person/being?
Bonus question: if Herp is all-powerful, what is he protecting his kid from in the first place?
I agree 100% with what you wrote here. The Book of Job presents a major contradiction to the idea of a benevolent, omniscient God. Which is why I think Dan Barker majorly dropped the ball here on what should have been a slam dunk.
>> ^hpqp:
But the whole point here is that the religious mindset causes an otherwise moral person (they all agreed the first scenario was wrong) to condone an immoral action if it was for religious reasons. Case in point: suicide and murder in Islam, both major "sins", are seen as okay if part of Jihad.
See, if this was Dan Barker's point, I think he screwed it up royally. He's comparing apples and oranges. I can do the same thing he did and get the same results with a completely non-religious issue:
Let's say someone breaks in a family's home in the middle of the night and terrorizes them--holds them at gunpoint, ties them up, and tortures them (similar to the original example). After having his way with them for some time, the criminal starts to kill each family member in front of the others, starting with the kids. After killing the wife, the criminal is about to kill the husband when the husband is able to break free of his bindings. A struggle ensues and the husband overcomes the criminal and ties the criminal up.
Now, remember, the criminal is secure. The husband makes sure the binds are tight and the criminal can't go anywhere. Instead of calling the police, though, the husband picks up the criminal's gun and shoots the criminal right in the head, instantly killing him. Is the husband a murderer?
I think you would find a majority of people who say yes.
The criminal was subdued and no longer a threat. In the American legal system, the husband would most likely be found guilty of second degree murder or manslaughter. It was clearly a revenge killing and the only thing in question really is the mental state of the husband at the time it takes place: was he upset enough that it was manslaughter or did he do it in cold blood?
Now, let's change the scenario slightly. The husband never breaks free. The criminal gleefully and cruelly kills him. After fleeing from the scene of the crime, the criminal later is captured by police and put on trial for his crimes. He's found guilty on all counts due to overwhelming evidence and is sentenced to death. After a lengthy appeals process that takes over a decade, the death sentence is carried out by the state.
Question: Is the state guilty of murder?
You will find that far fewer people are willing to say that the state is guilty of murder. But why don't they? Isn't it the same situation? The criminal is just as guilty of the crimes in either case--the trial just made the guilt official. The criminal has been apprehended and is secure in prison. Surrounded by thick walls, steel bars, and armed guards, he no longer represents a threat to the public. At his execution he is tied down and given a lethal injection (which is dissimilar from being tied up and shot in the head really only in the amount mess that needs to be cleaned up afterwards).
So what's different? What's "clouding the moral judgment" of the people who declare the husband guilty of murder but won't declare the state guilty of murder? Aren't they contradicting themselves?
No, not really. The answer is simply that people attribute different rights to people than they do to government. Almost any basic definition of government requires that government be authorized to use force to obtain compliance from the governed (see Weber's theory)--up too and including lethal force. People who don't believe the state to be guilty of murder believe the state has the right to deprive those who commit serious enough crimes of their life (for a variety of stated reasons such as discouraging other criminals, providing justice for the victims, etc.). An individual, on the other hand, does not have such a right. In other words, it's immoral for the individual to redress the wrong themselves, but it isn't immoral for the state to do so, according to death penalty proponents, on the basis of individual and governmental rights.
(For the record, I am strongly opposed to the death penalty. If you're interested in my reasons, please ask me on my profile rather than derail this thread).
And that is why Dan got the audience response he did. People agree that a human butchering another human is immoral, but ascribe a different set of rights to the Biblical God. In particular, in the more conservative Christian traditions, humans are seen as "belonging" to the Biblical God and to be done with as He pleases.
So I wasn't surprised at all at the response that Dan Barker got. He compared apples and oranges and then seemed surprise when people weren't willing to claim an apple was an orange. Given how ripe the Book of Job is for criticizing many of the basic tenets of Christian belief, I kind of face-palmed when I heard his argument. He had a great chance here to make some keen points (the ones @hpqp raised above) and he completely missed it, I think. What he certainly didn't show was that the audience condoned immoral actions by humans in the name of religion. He simply showed that Christians ascribe different rights to their god than they do to humans. He seems outraged by that, but--as I just showed above--many of us do the same sort of thing with non-religious institutions like government so I'm not sure why he seems so shocked.
So in summary--I didn't upvote because I found the argument to be weak-sauce.