search results matching tag: replicate
» channel: learn
go advanced with your query
Search took 0.000 seconds
Videos (109) | Sift Talk (5) | Blogs (1) | Comments (376) |
Videos (109) | Sift Talk (5) | Blogs (1) | Comments (376) |
Not yet a member? No problem!
Sign-up just takes a second.
Forgot your password?
Recover it now.
Already signed up?
Log in now.
Forgot your password?
Recover it now.
Not yet a member? No problem!
Sign-up just takes a second.
Remember your password?
Log in now.
25 Accidental Inventions That Changed The World
"Biotechnological self-replicating microchips, an eventuality; The human race will synthesize or become by-products of evolution."
-Itzhak Zechrevitz
Yeah so this is happening now [embed fun] (Mystery Talk Post)
No, only if my link drops. Replicate by loading a page, turning off your wifi for a few seconds, or unplugging the cable if you have a wired link, and then try an upvote.
I very rarely load a new featured video from the home page though, I normally browse the unsifted queue and if I do open a promoted one I tend to open it in a new tab.
Does it happen after you load a new featured video on the home page? Because I can easily reproduce this in my web browsers and multiple computers. Yes, I reported it but administrators could not reproduce it.
noam chomsky-how climate change became a liberal hoax
On a daily basis, politicians, like Obama, and pundits in the lamestream media mindlessly bump their gums about global warming, uh... "climate change" (the term employed when the earth stopped warming), without having the slightest idea what they are talking about. Most simply parrot the line about a "so-called "consensus of scientists," without the slightest knowledge of the science or data, or point to extreme weather events as “proof.” Al Gore and Henry Waxman have become masters at this. Noam Chomsky should stick to linguistics. Once he ventures outside of his specialty, he’s just a run-of-the-mill leftist loon.
Science does not operate on the basis of consensus, but provable fact and hard DATA that is replicable. No one can prove that C02 causes warming, apart from the other forces that are chiefly determinative of climate--solar output, cosmic rays (and their effect on cloud cover), the earth's elliptical orbit, its axial tilt, etc. The earth's climate cycle has been in place for eons and is not being altered by any significant degree by anthropogenic CO2. In fact, 99% of the people who believe in the "global warming crisis" cannot even tell you what the current globally-averaged temperature is, nor how much it may have risen over the past century (or any other time frame for that matter). Nor do they know that the current globally averaged temperature is 1-2 degrees C below what it was during the Medieval Warm Period, when human activity could not have been a factor.
Neither temperatures nor sea level rise are accelerating. Temperatures haven't risen since 1997. And even the U.N. predicts just an 8.5" to 18.5" sea level rise by 2100 (2007 IPCC Report), far below the 20 feet predicted by Al Gore, or the 35 feet predicted by Joe Lieberman in 2002. In fact, sea levels have been rising at a rate of about 7" per century since the end of the last age 12,500 years ago, so the U.N.'s predicted range is likely to fall at the low end.
Weather stations around the world are notoriously unreliable, many placed in locations now near asphalt parking lots, etc., replicating the urban island heat effect. Calculating the globally averaged temperature in an enormously complex task. compounded when scientific frauds like Phil Jones and Michael Mann (of the infamous "hockey stick" graph) hide, and would not supply, their data because it does not support their predetermined conclusions of anthropogenic global warming. (Climategate). This is not surprising, however, since thousands of scientists stand to collectively lose billions in federal research grants if the hoax is exposed (more than $80 billion has already been spent on such research, nearly 500 times what oil companies have spent to fund so-called “skeptics”), a fact totally lost, or grossly misrepresented, by global warming religionists.
The fact is: even if the earth's temperature is rising marginally, from natural forces, it will be far better for mankind than falling temperatures. It will result in higher crop yields and less death around the world. More than twice as many people die of extreme cold than extreme heat.
Contrary to morons such as Al Gore (who will never agree to debate the topic, so fearful is he of getting his clock cleaned), scientific evidence clearly shows that we have had no increase in extreme weather events. Dr. Roger Pielke Jr., Professor of Environmental Studies at the University of Colorado, summed up the latest science on weather extremes when he wrote that “There is no evidence that disasters are getting worse because of climate change....There's really no evidence that we're in the midst of an extreme weather era - whether man has influenced climate or not,”
Pielke also explained that the data does not support linking Hurricane Sandy to man-made global warming. “Sandy was terrible, but we're currently in a relative hurricane 'drought'.” But that doesn’t stop politicians from trying to make political hay from them.
Much of the gum bumping about "global warming" may be attributed to the political aspirations of Al Gore who hoped to ride an environmental white horse into the White House. It all comes down to a politically-motivated overreaction to a 0.35 degree C increase in globally-averaged temperatures in the period from 1978-1997. Since 1998, temperatures have flat-lined. They are now at 14.5 degrees Celsius which is exactly where they were in 1997. What this amounted to was a hyperbolic response to a temporary and cyclical climate phenomenon, which has been replicated a myriad of times in human history.
The climate history of the 20th century, by itself, contradicts the CO2 equals warming hypothesis. From 1913-1945, CO2 was not a factor and temperatures rose slightly. And from 1945-1977, temperatures fell in the face of rising CO2. It was only in the period from 1978-1997 that temperatures and CO2 rose simultaneously. But since CO2 is likely to continue to rise for the foreseeable future, we will have periods of both rising and falling temperatures in the face of rising CO2.
The scientific travesty is that many politicians are trying to transform CO2 into a “pollutant” requiring draconian federal regulations whose only effect will be to stifle economic growth. CO2 is a harmless trace element constituting just 0.039 per cent of the earth's atmosphere (390 parts per million by volume). It's what humans and animals exhale and its presence helps plant production. 500 million years ago, CO was 20 times more prevalent in our atmosphere. The aim is to convince the uninformed that carbon dioxide is the equivalent of carbon monoxide, a highly toxic gas.
With time and historical perspective, the global warming crisis will turn out to be the greatest scientific fraud in history. But that won’t politicians from exploiting it in the short term.
On a daily basis, politicians, like Obama, and pundits mindlessly bump their gums about global warming, uh... "climate change" (the term employed when the earth stopped warming), without having the slightest idea what they are talking about. Malloy is just the latest in a long line of demagogic politicians trying to capitalize on the scare. Most simply parrot the line about a "so-called "consensus of scientists," without the slightest knowledge of the science or data, or point to extreme weather events as “proof.”
Science does not operate on the basis of consensus, but provable fact and hard DATA that is replicable. No one can prove that C02 causes warming, apart from the other forces that are chiefly determinative of climate--solar output, cosmic rays (and their effect on cloud cover), the earth's elliptical orbit, its axial tilt, etc. The earth's climate cycle has been in place for eons and is not being altered by any significant degree by anthropogenic CO2. In fact, 99% of the people who believe in the "global warming crisis" cannot even tell you what the current globally-averaged temperature is, nor how much it may have risen over the past century (or any other time frame for that matter). Nor do they know that the current globally averaged temperature is 1-2 degrees C below what it was during the Medieval Warm Period, when human activity could not have been a factor.
Neither temperatures nor sea level rise are accelerating. Temperatures haven't risen since 1997. And even the U.N. predicts just an 8.5" to 18.5" sea level rise by 2100 (2007 IPCC Report), far below the 20 feet predicted by Al Gore, or the 35 feet predicted by Joe Lieberman in 2002. In fact, sea levels have been rising at a rate of about 7" per century since the end of the last age 12,500 years ago, so the U.N.'s predicted range is likely to fall at the low end.
Weather stations around the world are notoriously unreliable, many placed in locations now near asphalt parking lots, etc., replicating the urban island heat effect. Calculating the globally averaged temperature in an enormously complex task. compounded when scientific frauds like Phil Jones and Michael Mann (of the infamous "hockey stick" graph) hide, and would not supply, their data because it does not support their predetermined conclusions of anthropogenic global warming. (Climategate). This is not surprising, however, since thousands of scientists stand to collectively lose billions in federal research grants if the hoax is exposed (more than $80 billion has already been spent on such research, nearly 500 times what oil companies have spent to fund so-called “skeptics”).
The fact is: even if the earth's temperature is rising marginally, from natural forces, it will be far better for mankind than falling temperatures. It will result in higher crop yields and less death around the world. More than twice as many people die of extreme cold than extreme heat. The scientific evidence clearly shows that we have had no increase in extreme weather events. Dr. Roger Pielke Jr., Professor of Environmental Studies at the University of Colorado, summed up the latest science on weather extremes when he wrote that “There is no evidence that disasters are getting worse because of climate change....There's really no evidence that we're in the midst of an extreme weather era - whether man has influenced climate or not,”
Pielke also explained that the data does not support linking Hurricane Sandy to man-made global warming. “Sandy was terrible, but we're currently in a relative hurricane 'drought'.” But that doesn’t stop politicians from trying to make political hay from them.
Much of the gum bumping about "global warming" may be attributed to the political aspirations of Al Gore who hoped to ride an environmental white horse into the White House. It all comes down to a politically-motivated overreaction to a 0.35 degree C increase in globally-averaged temperatures in the period from 1978-1997. Since 1998, as Mr. Hart correctly points out, temperatures have flat-lined or declined. What this amounted to was a hyperbolic response to a temporary and cyclical climate phenomenon, which has been replicated a myriad of times in human history.
The climate history of the 20th century, by itself, contradicts the CO2 equals warming hypothesis. From 1913-1945, CO2 was not a factor and temperatures rose slightly. And from 1945-1977, temperatures fell in the face of rising CO2. It was only in the period from 1978-1997 that temperatures and CO2 rose simultaneously. But since CO2 is likely to continue to rise for the foreseeable future, we will have periods of both rising and falling temperatures in the face of rising CO2.
The scientific travesty is that many politicians are trying to transform CO2 into a “pollutant” requiring draconian federal regulations whose only effect will be to stifle economic growth. CO2 is a harmless trace element constituting just 0.039 per cent of the earth's atmosphere (390 parts per million by volume). It's what humans and animals exhale and its presence helps plant production. 500 million years ago, CO was 20 times more prevalent in our atmosphere. The aim is to convince the uninformed that carbon dioxide is the equivalent of carbon monoxide, a highly toxic gas.
With time and historical perspective, the global warming crisis will turn out to be the greatest scientific fraud in history. But that won’t politicians from exploiting it in the short term. Obama has already wasted billions trying to fix a non-problem.
And now he’s even orchestrating the mindless followers of a new secular religion to march on the Mall to advance this silly agenda.
Realtime PhysX Position Based Fluids Demonstration
Well lets see...if it EXACTLY REPLICATES what real water would do then I'd say that would "fool the user". So that should be the goal. So don't kid yourself. The goal is to accurately model what real water would do.
Does it really matter? The goal is not to accurately model what water would do, but to look similar enough that it fools the observer.
BANNED TED Talks Graham Hancock on Consciousness Emergence
I cannot figure out what you are trying to debate? That there is no science behind DMT? That there is nothing to DMT? That "spiritual" does not exist? What is your point of this continued conversation? That you are scared of psychedelics? Why do you think such an experience would have been programmed into our head, the most powerful experience a person can have?
I have trouble understanding "spiritual" to be the same as "awesome" or "awe-inspiring", but if thats what you mean by "spiritual", I suppose we agree. I understand "spiritual" to mean "that which concerns the spirits or the spiritual world", ie something supernatural.
I suppose there is little point in continuing this debate, I get a little carried away.. My point ws only that it is unscientific and nonsensical to think that stimulating your brain with chemicals can help you discover some sor of spiritworld or some nonsense like that, the reason I KNOW this, as you put it, is what I've fruitlessly to express over several long comments. Basically, to repeat myself for like the 5th time, it has to do with basic facts of the origin of our brains and so forth, it is now established, beyond any reasonable doubt, that our brains evolved. If you understand what biological evolution is and how it works, you'd know it is the mindless reshuffling of nucleotides acted upon in populations of animals over countless generations, this produces amazing survival machines, and some of them develop brains, and some of those grow big brains.
How do you think DNA evolved over so many years,
DNA probably evolved after RNA, nobody knows exactly how replicating nucleotides started to replicate, it was probably a staggeringly unlikely event, but then there was literally all the time and space in the universe for it to happen..
you ever read Francis Cricks, who helped found DNA, Well, I've read The Double Helix, and I'm currently studying biology and genetics.
what his theory for DNA was? Panspermia. Yeah.
No,
It was speculation, probably tongue-in-cheek that he later regretted. In any case, the argument was based on the fact that the origin of DNA/RNA was an extremely unlikely event, and that if it didn't originate on earth, it could have been brought here from elsewhere. Both options are essentially saying the same thing, that abiogenesis happened and that it later evolved (either here on earth, like most scientist now think, or somewhere else.)
It doesnt really matter whether directed panspermia is true or not, DNA is still strings of molecules that abide by the laws of physics and chemistry. They are not some sort of magical quantum spirit crystals mind-controlled by aliens.
The Universe is a lot trickier than just our basic Science.
Whatever you say boss.
Evil Picard Plays His Flute
Always wanted to see one of the crew walk to the replicator and say "Gun, Colt 1911, One bullet"...
Window seat please.
Sound Lamborghini V10 on the can of beer
This video has been seconded as a duplicate; transferring votes to the original video and killing this dupe - dupeof seconded with isdupe by chingalera.
Sound Lamborghini V10 on the can of beer
This video has been nominated as a duplicate of this video by jonny. If this nomination is seconded with *isdupe, the video will be killed and its votes transferred to the original.
Sound Lamborghini V10 on the can of beer
this is a subset of the original
*dupeof=http://videosift.com/video/Using-a-beer-can-to-replicate-the-sound-of-a-Lamborghini-V10
Creationist Senator Can E. Coli Turn Into a Person?
It is absurd, but it is also evidently, and provably true. It is a fact. Back in the days of Darwin one could perhaps make the case that the idea of common descent was perhaps stretching it far, but the discovery and later sequencing of DNA makes it a slam dunk. There is no other even remotely reasonable conclusion you can make, but the one that says you are related to a tomato. and elephants, and chimps, and E.Coli and shrimps and everything else that has DNA. Not only do we all share the same basic system (why doesn't some species use different nucleic acids or something else to replicate?) But we share the SAME CODE. Even with our most distant cousins (something like E.Coli) have long strands of DNA code in common with us. The four nucleic acids of DNA , represented by the letters A,T,C and G are laid down by the thousands in patterns like: AAAATTCGGGTATTTATTTGCAAACCTTTT, and then we find the SAME CODE in completely "unrelated" species. But thats not all, the relatedness of the code is excactly what you would expect in the taxonomic tree, and infact it is now THE method for figuring out exactly how related one species is to another, and drawing the correct tree.
So all life IS related, which means it all has a common ancestor, which lived some 3 billion years ago. Which also means it had to be a simple form that diverged into all that we now have. And that process is evolution, and the main driving forceof evolution, by far, is natural selection. So we know that this process happens and that it can create amazing things from really much simpler things. All we need to postulate is the capability to self-replicate for those first replicators. Admittedly, this is pretty hard to envision, but we do know that all the basic building blocks (organic molecules) could arise spontaneously through non-replication. But we may never know exactly how it started, it would be something simple, like some organic molecules spontaneously forming RNA strands, which break in two and each half collects its counter-parts and form two RNA strands and so on...
Evolution is real. However to imply or believe that all things evolved from the utter basic building blocks to what we have today is absurd.
More Faux Rage from Ann Coulter
I've looked at the numbers. Here's a better correlation: http://www.motherjones.com/environment/2013/01/lead-crime-link-gasoline
The studies have been done ad nauseum. They don't show any reliable (i.e. replicable) impact. IMO the data suggests it's better to attack the root causes of violence and criminal activity (e.g. poverty, parenting, education, mental health) than it is to wage a campaign of prohibition.
"Gun control is placebo policy at best, and autocracy at worst."
How do you know that if you haven't done a study on it? We haven't tried a lot of things in the United States, yet everyone says it won't work.
I particularly love the sarcastic twats that say "We should ban crime and then we'd be safe." Really moron? Really? Because that makes any sort of sense. People are stupid and they need their guns taken away. If they prove they're responsible and smart they can have their guns back.
Cooking Channel Contest (Food Talk Post)
Final Update:
There are 3 contestants for our recipe contest, one by the way which was butt-stupid easy to enter and win, so reflects the confidence of our trio of takers, pumpkinandstorm, dystopianfuturetoday, and sheppard.
P&S has offered-up another recipe which I chose over the one already listed here:
To follow are the 3 recipes I shall replicate and somewhat summarily present for judgement to a neutral third-party judge, whose culinary judgement I trust impeccably due his years of discipline and dedication to all things gustatory. Plus, he's brutally honest, like I aspire to be.
VideoSift 5.0 bugs go here. (Sift Talk Post)
Unable to replicate. I'm using Firefox and did this:
1) Loaded videosift.com
2) Clicked on a video thumbnail in the listing
3) The video embed appeared
3) Started playback on the video
4) Clicked the little comment icon below the video
5) The comment window expanded open
6) Nothing happened to the video; it continued playing
When you are watching a video and click on the comment button, the video stops playing.
Michio Kaku: Can Nanotechnology Create Utopia?
In this fantasy world of his, he's not thinking that whoever owns the replicators has the power.
Replicators can be made scarce in his future.
Michio Kaku: Can Nanotechnology Create Utopia?
It's not a science video...
>> ^hpqp:
Oh please, this is just bad science. It's barely even worth cheap sci-fi. Where do you get the energy to run the replicator, eh? Does entropy ring a bell? Even without replicators humans are draining the earth of it's energetic resources (including the "sustainable" ones)...
Nice philosophical mindgame, like all utopias for that matter, but nowhere near hard science.
philosophy