more taxation = theft BS. By living here you are agreeing to be taxed to pay for things we all need. Like that pesky police force we all agree is necessary to a just state.

if you live here, you agree with these terms, thus no theft. If you don't like taxation, get out.

yet again we have this hypocrisy. when we agree to the terms of a contract when dealing with private business, no one complains when a business holds you to your end of the bargain. but when gov't tries to collect taxes you agree to pay and tries to hold you to your end of the bargain, suddenly it's this horrible thing.

If you want something, you have to pay for it and Libertarianism is just a way of saying "I want to get away with doing something that I know harms people" or "I want something but I don't want to have to pay for it" wrapped in delusion of freedom.

people throw around the word freedom but in reality, as @ChaosEngine pointed out. you give people freedom and they use it to fuck over other people. We haven't evolved to the point where we can realiably count on people not to fuck each other over. Someday maybe that will happen, but it certainly isn't today.

Voluntaryism is just Objectiveism and Meritocracy trying to divorce itself from the negative stigma of Ayn Rand. rebranding a failed idea to get gullible people to fall for it again. Legitimized avarice.

boy I sure didn't miss blankfist's one note charlie obsession with statism.

Did the people who come up with these ideas completely ignore the lessons they learned when they first became adults? When we're growing up, we hated our parents for imposing rules on us, when we first become adults and we have a first taste of freedom, we go nuts, we do extremely stupid things, harmful things. most adults do eventually learn that these things are harmful and *shock* learn to impose limits on themselves. Eventually they come to realize that their parents weren't jerks after all and they generally did have a good reason to impose rules on us. Sure there some shitty parents out there and the children of those shitty parents throw out the rules that didn't work when they become adults, but guess what, they don't throw out the system, they just come up with different rules. hopefully those rules are better, if not, we just try again.

There is this false notion of an adversarial relation between gov't and the people. PEOPLE CREATED GOV'T!!! gov't is just the current method by which we impose limits on ourselves. just like we do as we grow up. Sure, we don't have a perfect system. get used to it. If gov't truly wasn't necessary, we would have ditched it a long time ago. someday we will have the ability to self limit ourselves without a self-created third party, but that isn't today.

Probably isn't ever going to change until we evolve genetic memory of our parents/ancestors or we develop a way to download knowledge/experience Matrix-style so that instead of learning the hard way to not touch a stove because it's hot, we just already know it at birth or an earlier age.

How dare you! I wouldn't even dream of making fun. Especially in a grave matter like this! I take great offense at your accusation I wouldn't take my responsibility as a earnest contributor to this important discussion seriously. Shame on you and your ancestors!
Have a good day, sir! You get nothing!

I've often wondered why African Americans seem to have ignored or forgotten this aspect of their ancestors enslavement.

Religion is a helluva drug.

If our white ancestors didn't bring your ancestors from Africa, you wouldn't have to endur... oh wait.

He is mistaken when he says that Cooper "hardly hit him." Cooper actually knocked Ali into la,la, land. Ali himself said that he was hit so hard his ancestors felt it. If it wasn't for the bell and, most significantly, the deliberate cutting of Ali's glove - Dundee admitted it years later - Cooper may have won. Anyway, Ali, for me, is the greatest ever. And not just in the ring.

Bobknight's post is a great example of missing the point.

In that entire historical diatribe about how the Democratic Party is bad because of it's history he manages to completely ignore the ideas that formed the basis of the parties.

Hey Bob, if you read this let me ask you something. Do you really think the label "Democratic Party" has any meaning in the historical context you're so painfully trying to cite?

Do you think that the old south was full of liberals, or do you think the old south was conservative as ever and just the LABELS of what the party means changed?

Here's a history lesson for you, pal. The Democratic Party was started in the south as a conservative anti-federal, anti-government party. Sounds just like the south today. Sounds a lot like the republican party doesn't it?

Everything you criticize and ascribe to the "Democratic Party" you're laying the blame on the conservatives.

The democrats were the conservatives. Understand what that means?

The south didn't change, only the label of the party did. The republicans of the 19th century? They were the legacy of Hamilton's federalists, the industrialists, the northern bankers, supporters of strong central government, just the type of people you hate.

So when you condemn the democratic party history, you sound like an idiot coming from a conservative anti-federal government point of view. You're condemning the ancestors to your own movement.

You could call it the green party, or the birthday party for all it matters, it's the IDEAS that count.

The democrats were wrong in 1860 not because they were democrats, but because they were backward thinking, rural, anti-union, state rights supporters who plunged the whole country into a bloody war because they couldn't wake up and smell the 20th century coming.

Sounds like you'd get along with them famously! Doesn't it?

The problem with the Tea Party isn't who buys their bus rides, it's that, like you, they don't know what the fuck they're talking about.

I would maybe wait until I knew the person a bit better, and perhaps bring up the subject by talking about my own ancestors.

And then his transcended ancestors took a snapshot of our planet from the beginning to the end of humanity, but his fragile elderly mind couldn't handle the data and a black hole opened in his head.

The plodding reaction of some of these chums makes me wonder how their ancestors survived as hunter-gatherers.

I am a little perplexed by your interpretation because it seems you are just agreeing with what @jonny said. The comparison of military invasion versus illegal immigration is the one to which the Native American fellow in the video is alluding. He's almost speaking as if the murderous conquest of this land somehow equates with illegals trying to make a home here. (That's the "serious flaw" jonny referenced.)

But I think all the guy's really saying is "You're here illegally too, so STFU... P.S. Fuck you and your ancestors for waging genocide against my ancestors."

There is a serious flaw in this guy's argument. He's absolutely right that Europeans weren't invited here and committed genocide in order to colonize. But that doesn't really have anything to do with immigration. The land was taken from his ancestors by force. If any of the nutters he's yelling at were capable of thought beyond that of a parrot, they might point out that those who wish to immigrate illegally are free to try to take it by force themselves.

It is absurd, but it is also evidently, and provably true. It is a fact. Back in the days of Darwin one could perhaps make the case that the idea of common descent was perhaps stretching it far, but the discovery and later sequencing of DNA makes it a slam dunk. There is no other even remotely reasonable conclusion you can make, but the one that says you are related to a tomato. and elephants, and chimps, and E.Coli and shrimps and everything else that has DNA. Not only do we all share the same basic system (why doesn't some species use different nucleic acids or something else to replicate?) But we share the SAME CODE. Even with our most distant cousins (something like E.Coli) have long strands of DNA code in common with us. The four nucleic acids of DNA , represented by the letters A,T,C and G are laid down by the thousands in patterns like: AAAATTCGGGTATTTATTTGCAAACCTTTT, and then we find the SAME CODE in completely "unrelated" species. But thats not all, the relatedness of the code is excactly what you would expect in the taxonomic tree, and infact it is now THE method for figuring out exactly how related one species is to another, and drawing the correct tree.

So all life IS related, which means it all has a common ancestor, which lived some 3 billion years ago. Which also means it had to be a simple form that diverged into all that we now have. And that process is evolution, and the main driving forceof evolution, by far, is natural selection. So we know that this process happens and that it can create amazing things from really much simpler things. All we need to postulate is the capability to self-replicate for those first replicators. Admittedly, this is pretty hard to envision, but we do know that all the basic building blocks (organic molecules) could arise spontaneously through non-replication. But we may never know exactly how it started, it would be something simple, like some organic molecules spontaneously forming RNA strands, which break in two and each half collects its counter-parts and form two RNA strands and so on...

Whoa, whoa, whoa -- 20 seconds in and my mind is already blown... Only 93% of all human beings ever are currently dead? Think about how many generations of homo sapiens there have been, and consider that at any one time an individual is pretty lucky if they themself + generations of offspring currently living + generations of ancestors currently living is greater than or equal to 4.

Considering all that plus the 93% figure from this video, I have come to the conclusion that the only explanation is that we've gotten into the real business end of an exponential population growth curve and are currently massively, desperately overpopulated.

Violence, death and danger raises the stakes of a narrative and triggers the production of adrenaline in the minds of the viewer. Our ancient ancestors got the same rush by outrunning a grizzly bear. Luckily, we can tap into this brain narcotic with much less risk.

There are films that do seem to pointlessly revel in gore and suffering, most notably Saw 1-26, but Quentin certainly isn't guilty of this kind of torture porn. Steven Spielberg killed at least as many Nazis in Raiders of the Lost Ark as Quentin killed racist confederates in Django, but Spielberg never gets criticized for it. The violence in both films serve the dual purposes of making the bad guys really bad, and making the catharsis of revenge in the end really good.

Violence in media is a reflection of violence in culture, not the other way around. Quentin didn't dream up slavery, lynchings, torture, mutilation and the other types of racial violence in his film. That stuff really happened.

And to Spike Lee: Django blowing racists to hell with TNT is how Tarrentino deals with race in cinema. Mookie tossing a garbage can through the front window of Sal's pizzaria is how you deal with race in cinema. Both are great films with the same perspective on race done in completely different styles. Get over yourself. If you want to criticize a film about race directed by a white guy, do 'Crash', that movie was a patronizing pile of shit.

Lies begin when a non-omnipotent consciousness forms and that consciousness seeks, let's say, truth, yet finds only half truths that require mental gymnastics in order to believe. Sand exists. How? I don't know. God? It's only natural to invent things concept to fill in the gaps.

A civilization of people formed out of collective half truths has unfulfillable expectations in this world which creates the security breach which breeds more lies. Thus it becomes state authority creating lies to appease those that their ancestors lied to since the beginning of our time. Brother kills brother. How did your brother die? A member of the opposing tribe did it! Opposing tribe dies. Known "truth" then becomes fact and history remembers that a violent tribe of brother-killers was sacked.

Truth will ALWAYS be an illusion to mortal beings of limited perspective. Always. Even if you perceptively died and met God in Heaven, it still remains suspect that your experience could be a lie guided by carefully controlled stimuli. If there's a modicum of truth that we have observed with science, it's only truth within the system of our understanding of the universe, therefore not Truth.

Yes, science allows us to observe and our observations have allowed us to record "laws" of the universe, but even someone like Richard Feynman admits to making shit up and then, Presto! it makes the equation make sense. Lies. No matter how small, they can fill in the gaps just enough to create perceived truth. But that's mechanical truth. A mechanism just needs to work or not work. It doesn't matter if you did everything right using precise truth.

So you may think: If life is an illusion, then what about all of the scientific experiments which have allowed us to create civilization as we know it? Well, every game, or sandbox, follows rules, so experiments within that world can be valid in that world according to the laws that govern it, but it doesn't mean those laws are the Truth.

If the world we are in was akin to something like Minecraft, observation would indicate that the world is functional and that there are observations which can be repeated over and over again with the same or similar results, leading to the creation of technology. But what about the concept of a .JAR or .DLL? Checksum? How about a network? If we only know the observed laws of the current server we have access to observe, how do we record the Truth? Black box observation and nothing more. My kingdom for a scientist that can perform unit testing. A string theory unit tester might be a good start.

Anyway, just rambling for communal sanity, as always. Not all of us have picked a side, let alone a position of understanding in the universe to cling to like a crucifix or a meme.