Looks like the animator was smokin' banana PEELS during the colorization of the end sequence

"This is the captain. We're having a little problem with our entry sequence, so we may experience some slight turbulence and then... explode." - Hoban 'Wash' Washburn

It is absurd, but it is also evidently, and provably true. It is a fact. Back in the days of Darwin one could perhaps make the case that the idea of common descent was perhaps stretching it far, but the discovery and later sequencing of DNA makes it a slam dunk. There is no other even remotely reasonable conclusion you can make, but the one that says you are related to a tomato. and elephants, and chimps, and E.Coli and shrimps and everything else that has DNA. Not only do we all share the same basic system (why doesn't some species use different nucleic acids or something else to replicate?) But we share the SAME CODE. Even with our most distant cousins (something like E.Coli) have long strands of DNA code in common with us. The four nucleic acids of DNA , represented by the letters A,T,C and G are laid down by the thousands in patterns like: AAAATTCGGGTATTTATTTGCAAACCTTTT, and then we find the SAME CODE in completely "unrelated" species. But thats not all, the relatedness of the code is excactly what you would expect in the taxonomic tree, and infact it is now THE method for figuring out exactly how related one species is to another, and drawing the correct tree.

So all life IS related, which means it all has a common ancestor, which lived some 3 billion years ago. Which also means it had to be a simple form that diverged into all that we now have. And that process is evolution, and the main driving forceof evolution, by far, is natural selection. So we know that this process happens and that it can create amazing things from really much simpler things. All we need to postulate is the capability to self-replicate for those first replicators. Admittedly, this is pretty hard to envision, but we do know that all the basic building blocks (organic molecules) could arise spontaneously through non-replication. But we may never know exactly how it started, it would be something simple, like some organic molecules spontaneously forming RNA strands, which break in two and each half collects its counter-parts and form two RNA strands and so on...

Who lands a viking in front of an Ultralisk, honestly.

Actually, who builds Ultralisks? Oh nvm. Dream sequence.

Edit: Oh boy, wall of text crits for 10k.

His explanation was rather short and somewhat misleading. Maybe they thought a proper explanation would have been too dry or too lengthy to be of any interest for a sufficient number of their viewers.

tl:dr

If all rotor settings are indicated to be correct, a feedback loop within the circuit indicated a subset of correct connections on the plugboard, even if the initially assumed connection turned out to be wrong. It didn't show all connections, but enough to run it through a modified Enigma to determine if it's a false positive or in fact the correct setting. If it was correct, the rest could be done by hand.

----------------------- Long version -----------------------

Apologies in advance. We had to recreate parts of the Bombe as a simulation, but a) it's been a while and b) it was in German. I'll try to explain the concept behind it, hopefully without screwing it up entirely.

The combination of clear message and code snippet (2:25) is called a crib. This can be used to create a graph, wherein letters are the vertices and connections together with their numerical positions are the edges.

For example, at position 1, "A" corresponds to "W". So you'd create an edge between "A" and "W" and mark that edge as "1". At position 4, "B" corresponds to "T", so there's the edge marked as "4". All edges are bidirectional, the transformation at a specific position can go either way.

Once your graph is finished, you check for loops. These are essential. Without loops, you're boned. In this case, one loop can be found at positions 2,3,5 in form of "T->E->Q->T".

Here the Bombe comes into play. It uses scramblers, each combining all three rotors plus reflector of an enigma into one segment. This way, one Enigma setting is functionally equal to a single scrambler.

Now you can use those scramblers to create an electrical circuit that corresponds to your graph -- scrambler = edge. All scramblers are set to the same initial configuration. The first scramber remains at in the inital configuration, while the second and third get configurations in relation to their edge's numerical value. Configuration in this case means the value of their internal three rotors, so there are 26*26*26 possible settings within each scrambler.

It's basically a sequence of three encryptions.

Example: in our little TEQ triangle, the first scrambler (TE, 2) gets a random starting position. The second scrambler (QE, 5) gets turned three notches, the third scrambler (QT, 3) gets turned one notch. The initial configuration might be wrong, but only the relation between the scramblers matters. A wrong result simply tells you to turn all scramblers another notch, until you get it right.

You have a possibly correct setting when the output matches the input. Specifically, a voltage is applied to the wire of letter "T", leading into the first scrambler. And on a test register attached to the last scrambler, the wire of letter "T" should have a voltage on it as well. If the setting is incorrect, a different letter will light up. Similarly, all incorrect inputs for this particular setup will always light up a different letter at the the end, never the same (thanks to the reflector). If output equals input, you're golden. And if several loops are used, all with the same input/output letter, each of their outputs must equal the input.

To reduce the number of false positives, you need as many connected loops within the crib as possible.

So far, that's an Enigma without a plugboard. To account for that, they introduced feedback loops into the circuit. In our small scale case, the output of the third scrambler would be coupled back into the input of the first scrambler. The number of loops determines the number of possible outcomes with each specific setting. All of these are fed back into the first scrambler of each loop.

The plugboard, however, changed the input into the system of rotors. Instead of a "T" in our example, it might be a "Z", if those two letters were connected on the board.

A random hypothesis is made and fed into the machine. If the scramblers are set incorrectly, a different letter comes out at the end of each loop and is in return fed back into the first scramblers. Result: (almost) everything lights up. If you start with a good graph, everything will light up.

-----
A key element for this was the "diagonal board", which represented a) all possible connections on the plugboard and b) the bidirectional nature of those connections (AB = BA). Maybe it can be explained without pictures, but I sure as hell can't, so "a grid of all possible connections between scramblers and letters + forced reciprocity" will have to suffice.
-----

If, however, the setting was correct, a wrong hypothesis for the input connection merely meant that everything except the right connections was lit up.

Let's say the fix point of the loops in our graph is the letter "T". We assume that it's connected to the letter "Z" on the plugboard. A voltage is applied to "Z" on the test register, and thereby inserted into the circuit at the first scrambler. Loop #1 applies voltage to the letter "A" on the test register, #2 lights up "B", #3 lights up "F". These three outputs are now fed back into the first scrambler, so now the scrambler has voltage on ZABF, which in return lights up ZABF+GEK on the test register.
This goes on until everything except "U" is lit up on the test register. That means three things: a) the settings are correct, b) the hypothesis is wrong, c) "T" is connected to "U".

Reasons:
a) if the settings were incorrect, the entire register would be alive
b) if the hypothesis was correct, only the letter "Z" would be alive on the register
c) due to the feedback loop, the only way for the output to be "U" is if the input was also "U", and the reciprocity within the system makes it impossible for any other input to generate the output "U". Since "T" was the fix point for our loops, "T" is connected to "U".

Similarly, if the initial hypothesis is correct, everything on the test register except "U" stays dead.

The diagonal board provides registers for every single letter and allows the user to pick one as a test register. During operation, all the other registers serve as visual representations of the deductions based on the initial hypothesis. So you actually get to see more than just the initial connection, all based on the same concept.

Not to the death, the young bull does wake up in the end.

This is an incredible sequence from an incredible series.

Don't call it a comeback, I'll have hair for years.

I'm scared. I'm scared that my abilities are gone. I'm scared that I'm going to fuck this up, and I'm scared of you.

I don't wanna' start, but I will.

This is an invocation for anyone who hasn't begun, whose stuck in a terrible place between 0 and 1.

------

Let me realize that my past failures that follow through are no indication of my future performance, their just healthy little fires that are gonna' warm up my ass.

If my FILDI* is strong let me keep him in a velvet box until I really really need him.
If my FILDI* is weak let me feed him oranges and not let him gorge himself on ego and arrogance.

Let me not hit up my Facebook like it's a crack-pipe, keep the browser closed.

If I catch myself wearing a tutu (too), too fat too late too old, let me shake it off like a donkey would shake off something it doesn't like.

When I get that feeling in my stomach, you know that feeling when all the sudden you get a ball of energy and it shoots down into your legs and up into your arms and tells you to stand up and goto the refrigerator and get a cheese sandwich - that's my cheese monster talking. And my cheese monster will never be satisfied with cheddar, only the cheese of accomplishment.

Let me think about the people that I care about the most. And how when they fail or disappoint me I still love them, I still give them chances, and I still see the best in them - let me extend that generosity to myself.

Let me find and use metaphors to help me understand the world around me, and give me the strength to get rid of them when it's apparent that they no longer work.

Let me thank the parts of me that I don't understand or are outside of my control, like my creativity and my courage.
Let me remember that my courage is a wild dog, it won't just come when I call it. I have to chase it down and hold on as tight as I can.

Let me not be so vain to think that I am the sole author of my victories, and a victim of my defeats.

Let me remember that the unintended meaning that people project on what I do is neither my fault, nor something that I can take credit for.

Perfectionism may look good in his shiny shoes, but he's a little bit of an asshole and nobody invites him to their pool parties.

Let me remember that the impact of criticism is often not the intent of the critic, but when the intent is evil that's what the block button is for.

And when I eat my critique, let me be able to separate out the good advice from the bitter herbs.

*Can't understand the over-dub'd speech*

Let me not think of my work only as a stepping stone to something else, and if it is let me become fascinated by the shape of the stone.

Let me take the idea that has gotten me this far, and put it to bed. What I'm about to do will not be that. But it will be something.

There's no need to sharpen my pencils anymore, my pencils are sharp enough - even the dull ones will make a mark. Warts and all.



Let's start this shit up.

And god let me enjoy this, life isn't just a sequence of waiting for things to be done.


-----

* FILDI = Fuck it let's do it.

"Genome mapping" is misleading. That makes it sound like they are going to sequence your entire genome, when all they are doing is looking for a collection of alleles known to be associated with certain risks or ancestries. It's "genetic testing".

This guy is a human sequencer.

Epic dance sequence with a rainbow inducing guitar *beg

"I've already been on that red carpet." Michael Vick pee pad and the end sequence ... HAHAHAHAHA!! HILARIOUS!!=oD

Ok, I'll start with a few things that most people would probably agree with, but the police force currently would fight like hell to avoid. How about we decide to actually punish cops who break existing rules and laws. Use testing to weed out unbalanced power hungry or corrupt types from becoming cops. QUIT hiring COMBAT veterans to become PEACE officers. I'm sure there are many things that could be done to fix the problem with the police, its just that it's not being done because the police think the only problem is that we, the lowly people, dont always follow ALL commands,and sometimes we need to be put in our place. >> ^shveddy:
False dichotomy, among other things. There are innumerable intermediate steps between "allowing them to do whatever they want to you" and "shooting the motherfuckers." I'll admit that there is a point where armed resistance is warranted, but if you think that we have arrived anywhere near that point with enough frequency to warrant armed resistance, then you are crazy.
Yes, there are plenty of instances of people's rights being violated - but in 99.99% of those occasions, I think the problem can best be solved through other means.
Do I think that the students who got peppersprayed at UC Davis had their rights violated?
Yes, I do. But this guy seems to suggest that the proper response is for the students to pull guns and start a shoot-out. Let's imagine what that would look like for a second:
One of the students peers through the caustic mist with righteous fury and a wet t-shirt over his mouth. He can feel the comforting weight of his Barretta, held close to his heart in a chest holster, and he knows that this is the moment to act. He stands up tall despite the onslaught of bright orange asphyxiation, reaches for his piece and takes aim. Somewhat startled, the officer is suddenly defenseless with his canister and it is not long before he crumples to the ground in an ever expanding pool of blood. He basks in a brief moment of clarity before chaos reigns. His fellow students are quick to bear arms themselves, but the training, body armor and poise of the officers allows them a significant head start and the students suffer heavy casualties in this initial volley.
Not to be deterred by the deaths of their friends, the occupy movement takes up refuge in the life sciences building which, designed in the late sixties with a brutalist aesthetic, is mostly concrete and as such is a perfect fortress from which to outlast the ensuing siege and inspire innumerable citizens on the outside world to take up arms as well. Guerrilla warfare is the only tactic effective in such asymmetrical circumstances, and after a few weeks of violence the powers that be succumb to international pressure and agree to negotiate with the 99%...
...or we could launch an official investigation, fire the guy as a scapegoat after an admittedly long, expensive and cumbersome process, and let the public outrage that ensued lead to a more cautious approach to future student protests. Bloggers and editorialists collectively write millions of words on the subject, increasing awareness and generally shaming the agency that allowed it to happen.
Not perfect, but a whole hell of a lot more civilized.
Any time you use guns against a government entity in he US, you will eventually be caught and put in jail. Period. The only way to avoid this is to be a small part of a large popular movement that eventually overthrows the US government, and I don't see that ever happening with citizen gun-owners unless it involves guerrilla tactics. Imagine gunfights erupting at your local municipal buildings. Imagine pipe bombs at your local police station. People need to realize that this is what they are advocating when they argue for second amendment rights as a fourth check and balance.
If you disagree with that statement, feel free to fill in a reasonable sequence of events to span the gap between "guy whose fourth amendment rights are violated guns down cop" and "said guy is vindicated, and massive changes are made to our law enforcement policies." I suspect that we are far more likely to see a greater militarization of the police in response.
I humbly propose that we join the civilized world and come up with more creative ways to correct our problems.

False dichotomy, among other things. There are innumerable intermediate steps between "allowing them to do whatever they want to you" and "shooting the motherfuckers." I'll admit that there is a point where armed resistance is warranted, but if you think that we have arrived anywhere near that point with enough frequency to warrant armed resistance, then you are crazy.

Yes, there are plenty of instances of people's rights being violated - but in 99.99% of those occasions, I think the problem can best be solved through other means.

Do I think that the students who got peppersprayed at UC Davis had their rights violated?

Yes, I do. But this guy seems to suggest that the proper response is for the students to pull guns and start a shoot-out. Let's imagine what that would look like for a second:

One of the students peers through the caustic mist with righteous fury and a wet t-shirt over his mouth. He can feel the comforting weight of his Barretta, held close to his heart in a chest holster, and he knows that this is the moment to act. He stands up tall despite the onslaught of bright orange asphyxiation, reaches for his piece and takes aim. Somewhat startled, the officer is suddenly defenseless with his canister and it is not long before he crumples to the ground in an ever expanding pool of blood. He basks in a brief moment of clarity before chaos reigns. His fellow students are quick to bear arms themselves, but the training, body armor and poise of the officers allows them a significant head start and the students suffer heavy casualties in this initial volley.

Not to be deterred by the deaths of their friends, the occupy movement takes up refuge in the life sciences building which, designed in the late sixties with a brutalist aesthetic, is mostly concrete and as such is a perfect fortress from which to outlast the ensuing siege and inspire innumerable citizens on the outside world to take up arms as well. Guerrilla warfare is the only tactic effective in such asymmetrical circumstances, and after a few weeks of violence the powers that be succumb to international pressure and agree to negotiate with the 99%...

...or we could launch an official investigation, fire the guy as a scapegoat after an admittedly long, expensive and cumbersome process, and let the public outrage that ensued lead to a more cautious approach to future student protests. Bloggers and editorialists collectively write millions of words on the subject, increasing awareness and generally shaming the agency that allowed it to happen.

Not perfect, but a whole hell of a lot more civilized.

Any time you use guns against a government entity in he US, you will eventually be caught and put in jail. Period. The only way to avoid this is to be a small part of a large popular movement that eventually overthrows the US government, and I don't see that ever happening with citizen gun-owners unless it involves guerrilla tactics. Imagine gunfights erupting at your local municipal buildings. Imagine pipe bombs at your local police station. People need to realize that this is what they are advocating when they argue for second amendment rights as a fourth check and balance.

If you disagree with that statement, feel free to fill in a reasonable sequence of events to span the gap between "guy whose fourth amendment rights are violated guns down cop" and "said guy is vindicated, and massive changes are made to our law enforcement policies." I suspect that we are far more likely to see a greater militarization of the police in response.

I humbly propose that we join the civilized world and come up with more creative ways to correct our problems.

Thank god they got someone who actually knows how to direct a coherent action sequence for the latest Bond flick.

>> ^DrNoodles:

There goes an hour of my day, a glorious glorious hour. I wish it had a sequencer in it so I could compose some structure!

49152,3080,32832,40,50176,68,32776,1040,98368,65568,99344,65608,49156,4096,32832,20


http://www.audiotool.com/app