How do you KNOW?

Physics is something that is only beginning to be understood. The Laws of Physics are subjective to change. We will probably find out soon whether the speed of light is a constant it may be that the speed of light is not a constant.

My point is, is that we have barely even tipped our toes into the way everything works, while I trust science much more than any religion I am not arrogant enough to think that there are fundamental aspects of reality that we simply do not understand on any level.

Another point is, if you ever take DMT. Most people have no words to describe what they see. As stupid monkey humans we have defined vague terms to mean something. Even if someone thinks a DMT experience is spiritual, so what? Because it is chemicals in the brain? What basis do you have to say that having a spiritual experience is not considering it is based upon the science of the Universe? Spiritual, God, dark matter, death, even consciousness are terms that ill defined with monkey brains.

I think you believe that "spiritual" must mean dogmatic religion. Science in itself can be "spiritual", contemplating the Universe can be "spiritual". I repeat that term because at this point in our culture-less society that term is taboo. I know some people consider FUCKING to be "spiritual". I am not implying that I believe in any religion, I do not, at all. DMT is like experiencing the Universe in your own head. It is the one and only experience that is convincing enough to say that we know very little, it is the most humbling and powerful experience there is. And if there is one using endogenous chemicals, more powerful, I do not want to even know about it, myself.

I cannot figure out what you are trying to debate? That there is no science behind DMT? That there is nothing to DMT? That "spiritual" does not exist? What is your point of this continued conversation? That you are scared of psychedelics? Why do you think such an experience would have been programmed into our head, the most powerful experience a person can have? How do you think DNA evolved over so many years, you ever read Francis Cricks, who helped found DNA, what his theory for DNA was? Panspermia. Yeah. The Universe is a lot trickier than just our basic Science.

One thing is clear, you are never going to know what I am talking about until you have that experience. Why not? It has never killed anyone... you will think you have died because what you are witnessing is alien and defies explanation. It will be so awesome, that you will not even care that you died or think you have died. People should do it, even if it is just to be in awe of what your own vessel is capable of doing.

deep deep in our dna, googly eyes is just waiting to express itself

I'm in. my G+ account name is "Kulpims T'dna"

I do sort of find the honesty of it attractive. This creature had to die for you to eat. I'm not really sure if its that much more barbaric than what happens to the meat you buy at the supermarket. I mean, we've all probably eaten some poor chicken that spent its entire existence inside a tiny cage.

Meanwhile in parts of the UK and Europe we are running DNA tests on beef to check it for horse meat. This is the extent we have become distanced from the slaughter of the animals we eat. Frankly, after watching a pig being turned from living thing to bacon it made me wonder if it was a taboo meat in so many cultures simply because it was so upsetting to slaughter them. I try and remember that pig hanging on a hook bleeding out whenever I eat meat.

two of every animal just acknowledges DNA, the rest is all fluff!~

Naturally, I don't believe in capital punishment, but it seems to me their lethal injection procedure is too complicated for its own good. A massive opiate overdose (which could be delivered subQ or IM) would initially be euphoric, the person would fall asleep, stop breathing and then die of asphyxiation. There are caveats, of course (like they might not actually die and just end up severely brain-damaged from lack of oxygen), but these could be sorted with an additional injection of something more directly lethal once they were unconscious.

When it comes down to it, though, there really isn't a "humane" way to kill someone. Perhaps more or less "humane" ways, but it's still well down the "humane" spectrum.

Anyways, capital punishment seems to be more about vengeance than justice or problem solving. Also, given that it's not possible to undo, and the embarrassingly large number of cases overturned by DNA evidence as of late, it's just not worth it. People that truly are irredeemable psychopaths should just be given a lifetime sentence with no chance of parole. This wouldn't be a problem if they would stop incarcerating drug users for stupid-long periods of time. Prison should be for people incapable of living in society without causing harm to others. That's a case of mental illness, and should be treated as such.

Privatized prisons wouldn't like that, but if you eliminated all the incarcerated people who could be redeemable with the right treatment, we could direct our resources to maintaining and attempting to treat the truly criminally insane.

Bit of a rant, but the system seems to be broken and getting more broken all the time.

Totally aside from all the other idiocies here, is Donald Trump not aware that just because his birth certificate says that his father is Fred Trump it doesn't prove that his biological father is not someone or something else.
What's needed here is a DNA test which will of course prove that 98% of his DNA is identical to an orangutan.

Talking too much...it's in the DNA!

LOL @ you dumbasses. The engineers brought our DNA to earth in a little jar of black ochre jelly and then drank it and fell in a river.

It is absurd, but it is also evidently, and provably true. It is a fact. Back in the days of Darwin one could perhaps make the case that the idea of common descent was perhaps stretching it far, but the discovery and later sequencing of DNA makes it a slam dunk. There is no other even remotely reasonable conclusion you can make, but the one that says you are related to a tomato. and elephants, and chimps, and E.Coli and shrimps and everything else that has DNA. Not only do we all share the same basic system (why doesn't some species use different nucleic acids or something else to replicate?) But we share the SAME CODE. Even with our most distant cousins (something like E.Coli) have long strands of DNA code in common with us. The four nucleic acids of DNA , represented by the letters A,T,C and G are laid down by the thousands in patterns like: AAAATTCGGGTATTTATTTGCAAACCTTTT, and then we find the SAME CODE in completely "unrelated" species. But thats not all, the relatedness of the code is excactly what you would expect in the taxonomic tree, and infact it is now THE method for figuring out exactly how related one species is to another, and drawing the correct tree.

So all life IS related, which means it all has a common ancestor, which lived some 3 billion years ago. Which also means it had to be a simple form that diverged into all that we now have. And that process is evolution, and the main driving forceof evolution, by far, is natural selection. So we know that this process happens and that it can create amazing things from really much simpler things. All we need to postulate is the capability to self-replicate for those first replicators. Admittedly, this is pretty hard to envision, but we do know that all the basic building blocks (organic molecules) could arise spontaneously through non-replication. But we may never know exactly how it started, it would be something simple, like some organic molecules spontaneously forming RNA strands, which break in two and each half collects its counter-parts and form two RNA strands and so on...

Yeah I get annoyed by this and I'm gonna call you out on it especially since we had a major former NFL star in Junior Seau die from playing Football. Rugby is a very tough sport, made for very tough men, but they're not tougher than NFL football players because they don't wear pads. Players wearing pads hit eachother with a much greater velocity than Rugby players normally hit themselves...and they hit eachother in the head which is causing deaths.

I think you can make a similar comparison to boxing and bare knuckle fighting. In over 100 years of bare knuckle fighting no one has died from it, but an average of 4 people die from boxing related injuries in the US alone. The reason is because when you fight bare knuckle you don't go for the head as much...it hurts. In boxing you basically trade blows to the head for rounds and rounds severely damaging a brain.

So no, rugby players are not tougher than NFL players...or even soccer players. We should all do well to remember that we have similar DNA and sports with differing sets of challenges. I would say the toughest athletes in the world are ultra-marathon runners. Because nothing is more suggestive than the voice in your head telling you to stop.

So skinny little runners in short shorts that run over 100 miles in 120 degree temperatures are tougher than all of you. Have a nice day.

I don't understand the fuss about horse meat. The pig dna that they also found would worry me more.

(Only applies to Americans)

Unfortunately you have very little understanding of the US legal system.

A) Under the Constitution you HAVE NO RIGHT to privacy, of any short, whatsoever. The word privacy doesn't even exist. I am perfectly 100% legally allowed to sit on a public sidewalk and take pictures of you all day long. If I can see you, from that sidewalk (or any public space) I can photograph, video, draw or whatever your likeness to my hearts content. And there's absolutely nothing you can do about it. Period.

B) By US law, any previous offenses cannot be used against you. If they have footage of you kicking a cat on a sidewalk and you're being charged with a speeding ticket, they cannot use that footage for anything. If they do, you win. It's called a mistrial. Now, if you were being charged with animal abuse by your mom for kicking her cat, they still CANNOT use that footage. Unless, of course, it was her cat you kicked in the video. (This is why you hear being being charged with 7 counts of murder. The previous murders are not evidence that they committed the most recent one, but the evidence applies jointly to several cases such as DNA, weapon, motive, location etc. Same with the animal abuse. You could be charged with 2 counts of animal abuse, but someone would actually have to file that charge.)

C) They don't even store that video. You obviously believe big brother has invented some new fangled massive storage device. CCTV eats through tape/disk fairly quickly, especially higher resolution ones. An average McDonalds has around 12 CCTV's throughout the store. (It's been a while, so don't quote me.) That's a lot of footage. That's one of the big cons is that most systems only record 4 frames a second in SD. Most systems also only store the data for a few days. Essentially long enough for the store owner to realize something happened and pull the tapes.

D) Most CCTV's aren't even monitored. They're there for evidence after the fact. The City of Tampa was planning to use facial recognition software to look for known Top Wanted. Why? Because as much as you think there's a secret lair of lackies watching your every move, a person can only watch one screen full of people. When they're over 10,000 cameras in that city, that's 1% of the population watching monitors. Well, 3% if they go in shifts. And yet, I don't see a "CCTV Watchers Union" anywhere.

E) Again, you HAVE NO RIGHT TO PRIVACY. Only protection against unreasonable Search and Seizure. Which only protects you within private property, or articles on your body. As in, they cannot search you, your vehicle, house or business without a warrant. If you don't want people looking at you, stay inside, close the blinds, and use Amazon to buy everything you need.

I hope my keyboard is never used as evidence in a crime scene 'cause there's DNA all over it.