OK, so Why?

Why won't it enter the sponge? why won't the liquid enter the negative spaces in the sponge?

I do know there are some materials that don't absorb water - I have some dish towels (bought at the dollar store) that won't absorb water, absolutely useless. But I think that's different as I doubt they would absorb anything.

So why not Mercury? it's definitely more dense than water. Are the molecules larger than the H2O Molecule? I don't think it is, and even if it was, surly they are not larger than the holes in the sponge.

I'd like to see this tried with different types of sponges.

DNA is not a language. The word language implies that someone created it, but we haven't proven that. DNA contains molecules that do certain things. Those molecules could be interpreted as information, but so could any other matter, such as the rings of a tree. Just because DNA works a certain way doesn't mean that we get to slap any label we want on it.

How would I tell the difference between a universe that is designed, and one that wasn't? Just like I tell that anything else was designed. I compare the two. Do you have a designed universe for me to compare this one to?

The discovery of the DNA molecule and genetics in general.

Also, the complete and total lack of any empirical evidence of a supernatural creator.

Remember, Rupert Sheldrake *actually believes* in psychic powers.

In this video he sets up a bunch of straw-men arguments to knock down. Just by using (and abusing) the language of science and framing it inwords like "dogma" that we associate with religion doesn't mean that anything else you have to propose has any validity.

He believes that by "morphic resonance" that "natural systems, such as termite colonies, or pigeons, or orchid plants, or insulin molecules, inherit a collective memory from all previous things of their kind".

Hmmm. I'm waiting or your peer reviewed paper on this with interest.

True but the Atheist also holds the "belief" that there is not GOD. So which belief is more correct? For me to get into a biblical debate with you and the atheist sift community would be pointless. It's like the saying you can bring a horse to water but you can't make him drink. So this makes me search the web for other ways to argue the point. Here is 1 of them.

Mathematically speaking evolution falls flat on it face..
Lifted from site: http://www.freewebs.com/proofofgod/whataretheodds.htm



Suppose you take ten pennies and mark them from 1 to 10. Put them in your pocket and give them a good shake. Now try to draw them out in sequence from 1 to 10, putting each coin back in your pocket after each draw.

Your chance of drawing number 1 is 1 to 10.
Your chance of drawing 1 & 2 in succession is 1 in 100.
Your chance of drawing 1, 2 & 3 in succession would be one in a thousand.
Your chance of drawing 1, 2, 3 & 4 in succession would be one in 10,000.

And so on, until your chance of drawing from number 1 to number 10 in succession would reach the unbelievable figure of one chance in 10 billion. The object in dealing with so simple a problem is to show how enormously figures multiply against chance.

Sir Fred Hoyle similarly dismisses the notion that life could have started by random processes:

Imagine a blindfolded person trying to solve a Rubik’s cube. The chance against achieving perfect colour matching is about 50,000,000,000,000,000,000 to 1. These odds are roughly the same as those against just one of our body's 200,000 proteins having evolved randomly, by chance.

Now, just imagine, if life as we know it had come into existence by a stroke of chance, how much time would it have taken? To quote the biophysicist, Frank Allen:

Proteins are the essential constituents of all living cells, and they consist of the five elements, carbon, hydrogen, nitrogen, oxygen and sulphur, with possibly 40,000 atoms in the ponderous molecule. As there are 92 chemical elements in nature, all distributed at random, the chance that these five elements may come together to form the molecule, the quantity of matter that must be continually shaken up, and the length of time necessary to finish the task, can all be calculated. A Swiss mathematician, Charles Eugene Guye, has made the computation and finds that the odds against such an occurrence are 10^160, that is 10 multiplied by itself 160 times, a number far too large to be expressed in words. The amount of matter to be shaken together to produce a single molecule of protein would be millions of times greater than the whole universe. For it to occur on the earth alone would require many, almost endless billions (10^243) of years.

Proteins are made from long chains called amino-acids. The way those are put together matters enormously. If in the wrong way, they will not sustain life and may be poisons. Professor J.B. Leathes (England) has calculated that the links in the chain of quite a simple protein could be put together in millions of ways (10^48). It is impossible for all these chances to have coincided to build one molecule of protein.

But proteins, as chemicals, are without life. It is only when the mysterious life comes into them that they live. Only the infinite mind of God could have foreseen that such a molecule could be the abode of life, could have constructed it, and made it live.

Science, in attempt to calculate the age of the whole universe, has placed the figure at 50 billion years. Even such a prolonged duration is too short for the necessary proteinous molecule to have come into existence in a random fashion. When one applies the laws of chance to the probability of an event occurring in nature, such as the formation of a single protein molecule from the elements, even if we allow three billion years for the age of the Earth or more, there isn't enough time for the event to occur.

There are several ways in which the age of the Earth may be calculated from the point in time which at which it solidified. The best of all these methods is based on the physical changes in radioactive elements. Because of the steady emission or decay of their electric particles, they are gradually transformed into radio-inactive elements, the transformation of uranium into lead being of special interest to us. It has been established that this rate of transformation remains constant irrespective of extremely high temperatures or intense pressures. In this way we can calculate for how long the process of uranium disintegration has been at work beneath any given rock by examining the lead formed from it. And since uranium has existed beneath the layers of rock on the Earth's surface right from the time of its solidification, we can calculate from its disintegration rate the exact point in time the rock solidified.

In his book, Human Destiny, Le Comte Du nuoy has made an excellent, detailed analysis of this problem:

It is impossible because of the tremendous complexity of the question to lay down the basis for a calculation which would enable one to establish the probability of the spontaneous appearance of life on Earth.

The volume of the substance necessary for such a probability to take place is beyond all imagination. It would that of a sphere with a radius so great that light would take 10^82 years to cover this distance. The volume is incomparably greater than that of the whole universe including the farthest galaxies, whose light takes only 2x10^6 (two million) years to reach us. In brief, we would have to imagine a volume more than one sextillion, sextillion, sextillion times greater than the Einsteinian universe.

The probability for a single molecule of high dissymmetry to be formed by the action of chance and normal thermic agitation remains practically nill. Indeed, if we suppose 500 trillion shakings per second (5x10^14), which corresponds to the order of magnitude of light frequency (wave lengths comprised between 0.4 and 0.8 microns), we find that the time needed to form, on an average, one such molecule (degree of dissymmetry 0.9) in a material volume equal to that of our terrestrial globe (Earth) is about 10^243 billions of years (1 followed by 243 zeros)

But we must not forget that the Earth has only existed for two billion years and that life appeared about one billion years ago, as soon as the Earth had cooled.

Life itself is not even in question but merely one of the substances which constitute living beings. Now, one molecule is of no use. Hundreds of millions of identical ones are necessary. We would need much greater figures to "explain" the appearance of a series of similar molecules, the improbability increasing considerably, as we have seen for each new molecule (compound probability), and for each series of identical throws.

If the probability of appearance of a living cell could be expressed mathematically the previous figures would seem negligible. The problem was deliberately simplified in order to increase the probabilities.

Events which, even when we admit very numerous experiments, reactions or shakings per second, need an almost-infinitely longer time than the estimated duration of the Earth in order to have one chance, on an average to manifest themselves can, it would seem, be considered as impossible in the human sense.

It is totally impossible to account scientifically for all phenomena pertaining to life, its development and progressive evolution, and that, unless the foundations of modern science are overthrown, they are unexplainable.

We are faced by a hiatus in our knowledge. There is a gap between living and non-living matter which we have not been able to bridge.

The laws of chance cannot take into account or explain the fact that the properties of a cell are born out of the coordination of complexity and not out of the chaotic complexity of a mixture of gases. This transmissible, hereditary, continuous coordination entirely escapes our laws of chance.

Rare fluctuations do not explain qualitative facts; they only enable us to conceive that they are not impossible qualitatively.

Evolution is mathematically impossible

It would be impossible for chance to produce enough beneficial mutations—and just the right ones—to accomplish anything worthwhile.

"Based on probability factors . . any viable DNA strand having over 84 nucleotides cannot be the result of haphazard mutations. At that stage, the probabilities are 1 in 4.80 x 10^50. Such a number, if written out, would read 480,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000."
"Mathematicians agree that any requisite number beyond 10^50 has, statistically, a zero probability of occurrence."
I.L. Cohen, Darwin Was Wrong (1984), p. 205.

I cannot figure out what you are trying to debate? That there is no science behind DMT? That there is nothing to DMT? That "spiritual" does not exist? What is your point of this continued conversation? That you are scared of psychedelics? Why do you think such an experience would have been programmed into our head, the most powerful experience a person can have?

I have trouble understanding "spiritual" to be the same as "awesome" or "awe-inspiring", but if thats what you mean by "spiritual", I suppose we agree. I understand "spiritual" to mean "that which concerns the spirits or the spiritual world", ie something supernatural.

I suppose there is little point in continuing this debate, I get a little carried away.. My point ws only that it is unscientific and nonsensical to think that stimulating your brain with chemicals can help you discover some sor of spiritworld or some nonsense like that, the reason I KNOW this, as you put it, is what I've fruitlessly to express over several long comments. Basically, to repeat myself for like the 5th time, it has to do with basic facts of the origin of our brains and so forth, it is now established, beyond any reasonable doubt, that our brains evolved. If you understand what biological evolution is and how it works, you'd know it is the mindless reshuffling of nucleotides acted upon in populations of animals over countless generations, this produces amazing survival machines, and some of them develop brains, and some of those grow big brains.

How do you think DNA evolved over so many years,
DNA probably evolved after RNA, nobody knows exactly how replicating nucleotides started to replicate, it was probably a staggeringly unlikely event, but then there was literally all the time and space in the universe for it to happen..

you ever read Francis Cricks, who helped found DNA, Well, I've read The Double Helix, and I'm currently studying biology and genetics.
what his theory for DNA was? Panspermia. Yeah.
No,
It was speculation, probably tongue-in-cheek that he later regretted. In any case, the argument was based on the fact that the origin of DNA/RNA was an extremely unlikely event, and that if it didn't originate on earth, it could have been brought here from elsewhere. Both options are essentially saying the same thing, that abiogenesis happened and that it later evolved (either here on earth, like most scientist now think, or somewhere else.)

It doesnt really matter whether directed panspermia is true or not, DNA is still strings of molecules that abide by the laws of physics and chemistry. They are not some sort of magical quantum spirit crystals mind-controlled by aliens.
The Universe is a lot trickier than just our basic Science.
Whatever you say boss.

Jesus H Christ man.

If you can imagine this. Maybe you cannot because you lack any psychedelic experience. You take twenty sugar cubes of LSD. It comes on quick because you are taking a heroic dose,so in maybe ten minutes you feel it. Say you did that? You would trip HARD for a couple days maybe. Maybe a week. You would never get anywhere close to where DMT takes a person on one toke, in ten minutes. LSD is also a tryptamine like DMT, in fact LSD is a much more complex tryptamine.

So, you tell me. Why is it that after that first toke it takes seconds to pass the blood/brain barrier like sugar? Seems to me, that there is a neurological function for this experience, which would also cater to the fact of why it is so heavy. Forget the fact that you are going to feel like you are dead, that you have literally been killed, maybe that is what makes it spiritual; we live in a reductionist society as you clearly believe. Forget all of that. Why is it that this molecule is so far and beyond the other tryptamines, that one instantly goes into a trance? That is first and foremost. After scientists figure out that one, then they might be intrigued by the fact that the imagery is otherwordly, the sound are otherwordly that the experience is otherworldly. Again, no one knows why or how. But, for you. YOU SHOULD JUST SHUT UP AND DO IT

I initially swore at you and fantomas for being completely closed minded and ignorant. But, I would rather say: You do not know what you are talking about. If you did, you would NOT have said these things.

If there was ever something to discuss it should be this. Whatever this state of consciousness is, it must and should be studied more in depth. It is not nonsense. Anyone that says such nonsense obviously has not been graced with the molecule. And if you have not been graced by it and are saying anything about it, especially negative, I would say do not throw caution to the wind.... just SHUT YOUR FUCKING MOUTH.

No problem, the spirit molecule and the psychonaut voyages in general are interesting topics eternal. Also just noticed that we share the same birthday, so Happy Birthday two Mondays ago!

Thank you for the upvote regarding the spirit molecule!!!

Thanks for upvoting the spirit molecule!

What is religion anyway? Many of them exude the same principles of which I believe have some truth in all of them. Hinduism and Buddhism probably moreso than others but that is just me and what I have seen and learned.

Though there is definitely more verifiable truth to Math and Science. We were built and evolved in this intergalactic system, a system largely devoted to geometry... and an intergalactic system that we do not know much about.

We hardly even know how our brain functions and even less about the subconscious or what happens when we sleep, we know these aspects of our own being impact us, we can study the brain waves, we can hypnotize, we can slip in different molecules into our serotonin receptors, but we still do not understand why. It is a mystery yet to be solved. Much like this phenomenon we might believe as God. Eventually, I believe that we can figure out the science and it will be mindbogglingly simple creating much complexity. Akin to a simple formula as x=abs(x) or y=abs(y) or m=x*x+y*y or x=x/m+cx or y=y/m+cy. But, math will not contain the science of all of the states of being, spirit realms, and matter that do not relate to us on Earth. In my opinion this is only one life. The science of the next could be completely different.

Is God a deity or a they? The programmers of a gigantic reaction that occurs probably in many more places than we can imagine. Who are connected to everything. Maybe, it was a blob of energy that never knew it could create consciousness and the Earth evolved us to be conscious to protect it. Yeah, great job guys.

No one has that great of an idea because if it is real, it would be absolutely mind blowing and beyond all human comprehension, yet probably very simple once we understood it. There is only one way I know to reach out and touch a little bit of it on Earth and it is absolutely amazing and terrifying all at the same time and beyond human linguistics. Science so far is hardly trying to figure it out but it is science, because if all living things ingest this molecule that resides in everything and then is able to see through dimensional portals, into afterlife, through the universe, think it is dead because it is impossible otherwise... well that is Spirit Science something of which is only beginning to come to fruition.

I just think everyone is somewhat right, even Christianity, hehe, as long as they are teaching compassion and love; there is something to it be it group therapeutic, psychological, or really there is something much bigger going on that science has no way of quantifying. Again, I am not saying anyone is right or wrong but that there are truths in everything and to completely disregard them might not be the best approach, even if it is an amalgamation of prior knowledge so very twisted by imperialists throughout these two thousand plus years.

Science is what we need to get behind to begin unraveling these mysteries, even though it is a slow process. I bet that science will eventually grapple to learn that these mystical underpinnings of religions, cults and ancient sacraments... these things Christians call holy light, prayer, God, resurrection, afterlife, angels... fit into the coding of the universe. If string theory and quantum mechanics did not already open that can of worms up. But, I also doubt that whoever created this thing that we are, wants to be seen and would have put up many barriers, knowing full well that its creations would seek them or it out. Or maybe it is the exact opposite....

I was underwhelmed to say the least during the presentation... Media Molecule got the biggest applause of the night. Got excited for a moment when Blizzard came out, then was let down by the Diablo 3 announcement, was hoping for something more exciting, but even if they release Titan on anything but PC they won't announce it at all until Blizzcon so not sure what I was expecting there... and yeah, the guy coming out to say we'll announce the next Final Fantasy at E3 was a cheap shot. And nothing really new from Destiny. I think the whole event was best summed up by XBox's Major Nelson who said something along the lines of "Have an event announcing your new console and not show it, that's one way of doing it."

I use my PS3 mostly for Bluray (it was by far the cheapest way into Bluray at the time) and Netflix (as my 360 sucks on Netflix on my network for some reason) and rarely games, that's what my PC is for and 360... It was nice to see it is indeed using x86 as rumored, and I was a little lost on why they didn't at least mention that it does have a Bluray drive during the event... something they mentioned in a followup press release as if they forgot...

The question now is, does Microsoft show early or wait for E3 for the whole show? They could do an pre-E3 show and show how it should be done... This was just badly handled. I mean 2 hours for what could have taken 30 minutes tops... and I still would have at least showed the system.

It is absurd, but it is also evidently, and provably true. It is a fact. Back in the days of Darwin one could perhaps make the case that the idea of common descent was perhaps stretching it far, but the discovery and later sequencing of DNA makes it a slam dunk. There is no other even remotely reasonable conclusion you can make, but the one that says you are related to a tomato. and elephants, and chimps, and E.Coli and shrimps and everything else that has DNA. Not only do we all share the same basic system (why doesn't some species use different nucleic acids or something else to replicate?) But we share the SAME CODE. Even with our most distant cousins (something like E.Coli) have long strands of DNA code in common with us. The four nucleic acids of DNA , represented by the letters A,T,C and G are laid down by the thousands in patterns like: AAAATTCGGGTATTTATTTGCAAACCTTTT, and then we find the SAME CODE in completely "unrelated" species. But thats not all, the relatedness of the code is excactly what you would expect in the taxonomic tree, and infact it is now THE method for figuring out exactly how related one species is to another, and drawing the correct tree.

So all life IS related, which means it all has a common ancestor, which lived some 3 billion years ago. Which also means it had to be a simple form that diverged into all that we now have. And that process is evolution, and the main driving forceof evolution, by far, is natural selection. So we know that this process happens and that it can create amazing things from really much simpler things. All we need to postulate is the capability to self-replicate for those first replicators. Admittedly, this is pretty hard to envision, but we do know that all the basic building blocks (organic molecules) could arise spontaneously through non-replication. But we may never know exactly how it started, it would be something simple, like some organic molecules spontaneously forming RNA strands, which break in two and each half collects its counter-parts and form two RNA strands and so on...

No, firearms are not designed to "kill". They are designed to accelerate a projectile in a specified direction. Some projectiles are designed to expand when they hit flesh, other projectiles are designed to cut perfect holes in cardboard or paper. As a comparison example a knife is designed to part molecules and a hammer is designed to collide two masses together.

Their designated use is determined by a human's choice. They may be designated for use as a weapon or for putting holes in paper targets.

Just recently a lady decided to mow down someone who threw some chips at her car. You can use just about anything as a weapon even if it is designed for something else.

In regards to guns vs cars - he has a point. Cars do cause significantly more death each year. It's just not purposeful death, therefore it's a risk we take because it is impersonal - an "accident". I don't know the relative risk but I'd say you're more likely to die in a car accident than to be massacred. Should we accept one sort of premature death more readily than another? (I don't know)