search results matching tag: Chimp
» channel: learn
go advanced with your query
Search took 0.000 seconds
Videos (142) | Sift Talk (9) | Blogs (13) | Comments (449) |
Videos (142) | Sift Talk (9) | Blogs (13) | Comments (449) |
Not yet a member? No problem!
Sign-up just takes a second.
Forgot your password?
Recover it now.
Already signed up?
Log in now.
Forgot your password?
Recover it now.
Not yet a member? No problem!
Sign-up just takes a second.
Remember your password?
Log in now.
Kid Gets A Gag Gift...And Loves It
Domesticated/altered plants spread back into the wild all the time, and chimps have been here as long as we have, IOW, they have learned to recognize and eat bananas by quite literally reaping our fruits, so to speak. And even if you find a chimp/great ape or even a monkey that has never seen a banana, my bet is that its going to figure it out pretty quickly, they are curios and fast learners
I want to know this: do our normal yellow bananas grow wild through some sort of propagation from our selectively bred bananas? If not, how do animals (like captive apes) know what bananas are/how to eat them when we give them our yellow bananas, assuming they've come from a non-yellow banana area?
Chimp hugs Jane Goodall after being released into the wild
chimps have the most disgusting backsides on earth
Woman thinks all postal workers are after her
With that in mind here's a list of people that make me variously: scared, uncomfortable, upset and sometimes outright angry. I find it deeply unpleasant and sometimes disturbing to have to deal with them and I think life would be a lot better if we just locked them away.
Police
Politicians
Pro-lifers
Anyone who watches X-factor
Anyone who doesn't think the British royal family are murderous tyrants.
People who play music on their phone speakers on the bus/walking down the street.
People that use the term "free country" without irony.
The unregulated hyper rich over class.
Rugby players on a night out drinking.
People that advocate the death penalty.
Hyper nationalists.
Xenophobes, Racists and Homophobes.
The priesthood of amen/the brotherhood of shadow.
Young people in tracksuits/hoodies.
Anyone that uses the word "party" as a verb.
Practising Christians, Muslims and Jews (doubly so if they are raising their children religiously).
Hyper-Atheists.
Chimpanzees! (seriously, fuck the chimps they scare the shit out of me)
People that use the phrase "I just don't give a fuck" and actually mean it.
The Chinese scientists developing the "death robots" (you might laugh now....)
Whilst some are clearly more serious than others, all of the above represent things/traits which deeply concern me. Many of the people on that list I'd label as outright insane and/or seriously dangerous to my health and well being.
Some, were I to be confronted by them unexpectedly, would outright terrify me, much more so than that lady. There's a good chance that by simply responding with concern and a lack of antagonism she could have been talked down, but certainly pulling an incredulous expression and calling her a crazy lady is not likely to diffuse the situation one iota.
As I said before maybe she is a genuine danger to herself and others, such people do exist and there are systems in place to try and deal with it.
The issue here is that your not even remotely in a position to make that diagnosis, nor are any of us here. We don't know how serious her condition is or how likely she is to respond to various forms of treatment. Speculating based only on video's made during episodes (i.e. at her worst) with no context of her medical history just fuels the kind of knee jerk "lock them away" mindset that contributes heavily to these poor bastards getting the way they are in the 1st place.
For all you know a bit of in the community C.B.T. and mentoring might be all she needs/needed. Not everyone displaying psychotic symptoms benefits from or warrants full on institutional incarceration, it often makes things much worse.
She clearly needs/needed further investigation and perhaps having the benefit of her medical history and first hand interaction it might be reasonable to conclude that some form of isolation is needed. But I'd rather leave that down to those who are professionally qualified to make that judgement than bystanders who merely witnessed a few isolated psychotic episodes and know sweet F.A. about her as a person.
It's you that's failing to see the bigger picture here. You want to put her in a neat little box marked "crazy" so you don't have to face the implication that in some fundamental sense you are the same thing. The crazy person sits next to you on the bus and you think "I don't deserve to have to put up with this inconvenience. How dare they make me feel uncomfortable".......
....Do you have the remotest idea of the kind of deep lasting damage that does to a person when virtually everyone they ever meet thinks and behaves that way? How it feels for someone to just condemn you to be locked away without even attempting to understand what your all about?
It's only about 50 years ago that it was standard practice to basically label everything as just various forms of "madness" and lock them all away in the same building. While we've come along way there's still very much a ways to go and the public perception of acute psychotic illnesses is by far the most backwards.
If you'd said maybe she might need institutional treatment, or that you had concerns that the behaviour she displays could escalate to a violent incident (both legitimate concerns) then I wouldn't have reacted with such hostility.
But you didn't do that, you outright declared she that must be forcibly segregated and treated and moreover that she is definitely a danger to herself and others. No grey area, isolation is the only alternative!
I don't want this to descend into a personal attack, you might after all be a really nice person and this is a deeply rooted prejudice common to most people I come across. Much like many peoples homophobia isn't especially malicious it's just an unchallenged social convention (one fortunately that is changing).
But malicious or not the damage done is the same, for crazies, ethnic minorities and homosexuals alike. And I don't think its unfair to say that the "crazies" are the more vulnerable group by quite some margin.
You don't begrudge offering a little time and understanding for say a disabled person holding you up in a door way, why is taking a little step back when confronted with a "crazy" person so different? That postie clearly recognised she wasn't occupying the same reality as himself very quickly, but his response is to pull a face that says "what the fuck is your problem?" and just dismisses her as crazy. She might have calmed down and gone away peacefully in the space of a few mins if he'd tried to diffuse it, but he didn't, he escalated immediately. (because he's mentally ill too, just in a different way)
That's basically like someone getting in your way, you realizing its because they are in a wheel chair and then treating them like an arsehole because they had the indecency to be out in public and get in the way of the able bodied people! Those bloody cripples, they should be taken away for their own protection! (the fact the rest of us don't have to worry about dealing with them any more is just a bonus naturally )
Now obviously this is a somewhat flawed analogy as people with mobility impairments don't have heightened rates/likelihood of violent outbursts (though I'm sure there are plenty twats who just happen to be in wheelchairs). But the fundamental point I'm trying to make about how people treat the extravertly mentally ill stands. If your being directly threatened with no provocation is one thing, but this guy isn't he's just antagonising someone in a clear state of paranoia and delusion/misunderstanding (which he recognises within seconds). He doesn't even attempt to address that he just closes off and becomes passively hostile.
As I said before its understandable, but only in the same way as being frightened of homosexuality, alien cultures, physical disfigurement etc.. It's just cultural isolation, get to know a few people from any of those groups and it quickly starts to sublime into respect and understanding.
She didn't walk up to him screaming she walked up and firmly presented an accusation that the postman knew could not possibly have been true. She became aggressive/shouty only after he became dismissive, before that she was only restless and paranoid. And even then she didn't make any aggressive physical moves we can see. Postie doesn't look at all in fear for his safety to me, he turns his back on her several times and barely maintains eye contact, not the behaviour of someone that feels physically threatened!
How might she have reacted if postie had looked genuinely scared? Maybe she'd have backed off? Changed her attitude? And yeh maybe she'd have got even more threatening or attacked him with a stick too.
We don't know what she'd have done because we don't know her or anything about her other than a few paranoid videos on the internet. Leave the judgements to the people that have done the research, interviews etc. and know know what the fuck they are talking about with regards to this lady's condition and best treatment.
Speculation is one thing, outright declarations of fact is quite another. People are not guilty before you can prove their innocence...
be discussed. it really doesn't make since to me how you can only look at it through her eyes. what about this mailman, who is just sitting there doing his job, then suddenly this insane woman come up to you screaming in your face? telling you your stalking her? and sounding like she going to do something violent? YES! they are "FUCKING PEOPLE"! but their people who need to be taken out of society for their own good and others around them. take your blinders off and look at the whole picture.
Lightning Strike Filmed at 11,000 FPS
If this were done by the BBC documentary guys, the clip wouldn't have been edited by a retarded chimp.
Still awesome, though
Why chimps don't play baseball
I think he meant draw cards.
@digitalpimp is a chimp. Ask him.
But can a chimpanzee draw?
How Chimp Chromosome #13 Proves Evolution
Ok then all we have to do to test this theory is take a chimp and fuse chromosome #13 together and we will create a human. I'm sure if it took millions of years to do by chance we would still see it occurring in nature with apes. Science is more than capable to do this now with the mapping of the human genome so lets see if they can make a human out of a monkey or will creation make a monkey out of the evolutionist?
Gorilla Pranks Zoo Workers
I was at a private animal park in Oregon as a kid, and there was a sign on the chimpanzee cage that urged visitors not to mimic or taunt the animals. One Dad with family in tow ignored it, and did the "ooh ooh ooh" sounds with his hands up at his armpits. An adult female calmly walked over, picked up a pile of shit and flung it underhand at him with great precision. The kids began to shriek and run away, and the female chimp laughed her ass off.
Dream Job
@artician has a point, I remember a Gary Larson story about a cartoon he'd done on Jane Goodall, one chimp is cleaning another and finds a blonde hair and accuses the other chimp of hanging around 'that Goodall tramp' again.
He got an angry letter from the Goodall foundation and shelved the cartoon, never to be published again.
Years later, he happened to be talking to someone else from the Goodall foundation and she brought the cartoon up. He told her about how he'd pulled it and would never re-print it anywhere because of the reaction, and she said, "That doesn't sound like Jane!"
She contacted Goodall who personally contacted Larson and told him she thought the cartoon was hilarious and he was welcome to re-print it as often as he liked.
Long story short, bureaucrats often get a bug up their ass about things that would never bother the true powers-that-be.
Looks like chimpazees can beat humans in memory tests
Chimps and Gorillas can learn sign language. I haven't heard of it spreading in the wild though.
Idiot Savant.
Very interesting. We need to figure out how to teach these guys how to talk. I'd wager it would make an interesting conversation. Would be pretty cool if humans caused a sort of chimpanzee singularity.
Then again, perhaps its their extraordinary ability at tasks like this that also prevent them from learning language. Maybe we should try giving them magic mushrooms?
Creationist Senator Can E. Coli Turn Into a Person?
It is absurd, but it is also evidently, and provably true. It is a fact. Back in the days of Darwin one could perhaps make the case that the idea of common descent was perhaps stretching it far, but the discovery and later sequencing of DNA makes it a slam dunk. There is no other even remotely reasonable conclusion you can make, but the one that says you are related to a tomato. and elephants, and chimps, and E.Coli and shrimps and everything else that has DNA. Not only do we all share the same basic system (why doesn't some species use different nucleic acids or something else to replicate?) But we share the SAME CODE. Even with our most distant cousins (something like E.Coli) have long strands of DNA code in common with us. The four nucleic acids of DNA , represented by the letters A,T,C and G are laid down by the thousands in patterns like: AAAATTCGGGTATTTATTTGCAAACCTTTT, and then we find the SAME CODE in completely "unrelated" species. But thats not all, the relatedness of the code is excactly what you would expect in the taxonomic tree, and infact it is now THE method for figuring out exactly how related one species is to another, and drawing the correct tree.
So all life IS related, which means it all has a common ancestor, which lived some 3 billion years ago. Which also means it had to be a simple form that diverged into all that we now have. And that process is evolution, and the main driving forceof evolution, by far, is natural selection. So we know that this process happens and that it can create amazing things from really much simpler things. All we need to postulate is the capability to self-replicate for those first replicators. Admittedly, this is pretty hard to envision, but we do know that all the basic building blocks (organic molecules) could arise spontaneously through non-replication. But we may never know exactly how it started, it would be something simple, like some organic molecules spontaneously forming RNA strands, which break in two and each half collects its counter-parts and form two RNA strands and so on...
Evolution is real. However to imply or believe that all things evolved from the utter basic building blocks to what we have today is absurd.
How to fool a baboon?
Tags for this video have been changed from 'how to fool a baboon, fool, trick, baboon, ape, monkey, chimp, stuck, hole, capture, catch' to 'Animals Are Beautiful People, trick, baboon, monkey, stuck, hole, capture, catch, water' - edited by grinter
Chimps vs. Raccoon WAIT FOR IT
Ok, I'll bite. I have no issue with the chimpanzees. They are just doing what they do. In the wild they hunt, and they will in captivity given the chance. They also struggle for stimulation in captivity hence the relish with which they approach this situation. It's a game to them, they know no better.
What really irks me about this video is the braying spectators. They way they find it funny that the raccoon is being treated this way. Just because it's natural doesn't mean it's OK to take pleasure in the suffering of another animal. They are laughing at an animal being hurt.
The chimps don't understand the situation, but the laughing idiots should. There are funny things in nature and there are horrific things in nature. The chimps are blameless, but that doesn't stop what they're doing from being horrific.
That's what my issue with this video is. By upvoting a video here people are saying 'yes, I enjoyed watching that'. I can't imagine who would enjoy watching this demonstration of the awfulness of people.
I don't understand why people are getting their panties in a bunch as much as they seem to do over this video. Especially the people chanting for the guy who was laughing to be torn limb by limb!?
How is it different from a cat playing with a mouse before eating it? Or the thousands of other examples of fucking NATURE!
Maybe something to do with them being bipedal? Might hit a bit too close to home for some people..
Also, there are no rules in the animal kingdom, so there are no "cheap shots".
Humans invented rules to all sorts of things in society, including fighting, and I'm pretty sure other animals don't really have that. At least not towards other species.
I'm not saying I enjoyed what the monkeys were doing to the little fella, but I can understand somebody laughing at the entire scenario unfolding before their eyes. To chant for his head on a stake seems worse than what the chimps were doing.
Chimps vs. Raccoon WAIT FOR IT
I don't understand why people are getting their panties in a bunch as much as they seem to do over this video. Especially the people chanting for the guy who was laughing to be torn limb by limb!?
How is it different from a cat playing with a mouse before eating it? Or the thousands of other examples of fucking NATURE!
Maybe something to do with them being bipedal? Might hit a bit too close to home for some people..
Also, there are no rules in the animal kingdom, so there are no "cheap shots".
Humans invented rules to all sorts of things in society, including fighting, and I'm pretty sure other animals don't really have that. At least not towards other species.
I'm not saying I enjoyed what the monkeys were doing to the little fella, but I can understand somebody laughing at the entire scenario unfolding before their eyes. To chant for his head on a stake seems worse than what the chimps were doing.
Lion Sneaks Up Behind Little Girl
>> ^spoco2:
>> ^Drachen_Jager:
>> ^spoco2:
It's so hard to not anthropomorphise anumals, but man that lioness looks sad
Animals can be sad. That's not anthromorphic at all. Do you think animals don't have emotions, or their emotions aren't often expressed in similar ways to ours?
No, I'm not saying animals can't be sad. What I'm saying is that the expression... it looks sad, so we think of the lioness as sad. But that expression could have nothing to do with sadness, it could be interested, hungry, angry... we don't really know, it's applying human facial characteristics to an animal to assume that the look means sad.
I agree. Animal expressions can be very similar to ours, but mean completely different things. When we smile we pull back our lips and reveal our teeth. This is seen as a friendly expression by humans, but in almost all other animals it's a threat response, something you do when hurt or threatened yourself. How do you make a chimp smile? Hurt it, make it feel threatened. Puts a new edge on the old PG tips ads in the UK...
kulpims (Member Profile)
Wow, haven't watched this one in forever. Thanks for the promote.
In reply to this comment by kulpims:
*promote