True but the Atheist also holds the "belief" that there is not GOD. So which belief is more correct? For me to get into a biblical debate with you and the atheist sift community would be pointless. It's like the saying you can bring a horse to water but you can't make him drink. So this makes me search the web for other ways to argue the point. Here is 1 of them.

Mathematically speaking evolution falls flat on it face..
Lifted from site: http://www.freewebs.com/proofofgod/whataretheodds.htm



Suppose you take ten pennies and mark them from 1 to 10. Put them in your pocket and give them a good shake. Now try to draw them out in sequence from 1 to 10, putting each coin back in your pocket after each draw.

Your chance of drawing number 1 is 1 to 10.
Your chance of drawing 1 & 2 in succession is 1 in 100.
Your chance of drawing 1, 2 & 3 in succession would be one in a thousand.
Your chance of drawing 1, 2, 3 & 4 in succession would be one in 10,000.

And so on, until your chance of drawing from number 1 to number 10 in succession would reach the unbelievable figure of one chance in 10 billion. The object in dealing with so simple a problem is to show how enormously figures multiply against chance.

Sir Fred Hoyle similarly dismisses the notion that life could have started by random processes:

Imagine a blindfolded person trying to solve a Rubik’s cube. The chance against achieving perfect colour matching is about 50,000,000,000,000,000,000 to 1. These odds are roughly the same as those against just one of our body's 200,000 proteins having evolved randomly, by chance.

Now, just imagine, if life as we know it had come into existence by a stroke of chance, how much time would it have taken? To quote the biophysicist, Frank Allen:

Proteins are the essential constituents of all living cells, and they consist of the five elements, carbon, hydrogen, nitrogen, oxygen and sulphur, with possibly 40,000 atoms in the ponderous molecule. As there are 92 chemical elements in nature, all distributed at random, the chance that these five elements may come together to form the molecule, the quantity of matter that must be continually shaken up, and the length of time necessary to finish the task, can all be calculated. A Swiss mathematician, Charles Eugene Guye, has made the computation and finds that the odds against such an occurrence are 10^160, that is 10 multiplied by itself 160 times, a number far too large to be expressed in words. The amount of matter to be shaken together to produce a single molecule of protein would be millions of times greater than the whole universe. For it to occur on the earth alone would require many, almost endless billions (10^243) of years.

Proteins are made from long chains called amino-acids. The way those are put together matters enormously. If in the wrong way, they will not sustain life and may be poisons. Professor J.B. Leathes (England) has calculated that the links in the chain of quite a simple protein could be put together in millions of ways (10^48). It is impossible for all these chances to have coincided to build one molecule of protein.

But proteins, as chemicals, are without life. It is only when the mysterious life comes into them that they live. Only the infinite mind of God could have foreseen that such a molecule could be the abode of life, could have constructed it, and made it live.

Science, in attempt to calculate the age of the whole universe, has placed the figure at 50 billion years. Even such a prolonged duration is too short for the necessary proteinous molecule to have come into existence in a random fashion. When one applies the laws of chance to the probability of an event occurring in nature, such as the formation of a single protein molecule from the elements, even if we allow three billion years for the age of the Earth or more, there isn't enough time for the event to occur.

There are several ways in which the age of the Earth may be calculated from the point in time which at which it solidified. The best of all these methods is based on the physical changes in radioactive elements. Because of the steady emission or decay of their electric particles, they are gradually transformed into radio-inactive elements, the transformation of uranium into lead being of special interest to us. It has been established that this rate of transformation remains constant irrespective of extremely high temperatures or intense pressures. In this way we can calculate for how long the process of uranium disintegration has been at work beneath any given rock by examining the lead formed from it. And since uranium has existed beneath the layers of rock on the Earth's surface right from the time of its solidification, we can calculate from its disintegration rate the exact point in time the rock solidified.

In his book, Human Destiny, Le Comte Du nuoy has made an excellent, detailed analysis of this problem:

It is impossible because of the tremendous complexity of the question to lay down the basis for a calculation which would enable one to establish the probability of the spontaneous appearance of life on Earth.

The volume of the substance necessary for such a probability to take place is beyond all imagination. It would that of a sphere with a radius so great that light would take 10^82 years to cover this distance. The volume is incomparably greater than that of the whole universe including the farthest galaxies, whose light takes only 2x10^6 (two million) years to reach us. In brief, we would have to imagine a volume more than one sextillion, sextillion, sextillion times greater than the Einsteinian universe.

The probability for a single molecule of high dissymmetry to be formed by the action of chance and normal thermic agitation remains practically nill. Indeed, if we suppose 500 trillion shakings per second (5x10^14), which corresponds to the order of magnitude of light frequency (wave lengths comprised between 0.4 and 0.8 microns), we find that the time needed to form, on an average, one such molecule (degree of dissymmetry 0.9) in a material volume equal to that of our terrestrial globe (Earth) is about 10^243 billions of years (1 followed by 243 zeros)

But we must not forget that the Earth has only existed for two billion years and that life appeared about one billion years ago, as soon as the Earth had cooled.

Life itself is not even in question but merely one of the substances which constitute living beings. Now, one molecule is of no use. Hundreds of millions of identical ones are necessary. We would need much greater figures to "explain" the appearance of a series of similar molecules, the improbability increasing considerably, as we have seen for each new molecule (compound probability), and for each series of identical throws.

If the probability of appearance of a living cell could be expressed mathematically the previous figures would seem negligible. The problem was deliberately simplified in order to increase the probabilities.

Events which, even when we admit very numerous experiments, reactions or shakings per second, need an almost-infinitely longer time than the estimated duration of the Earth in order to have one chance, on an average to manifest themselves can, it would seem, be considered as impossible in the human sense.

It is totally impossible to account scientifically for all phenomena pertaining to life, its development and progressive evolution, and that, unless the foundations of modern science are overthrown, they are unexplainable.

We are faced by a hiatus in our knowledge. There is a gap between living and non-living matter which we have not been able to bridge.

The laws of chance cannot take into account or explain the fact that the properties of a cell are born out of the coordination of complexity and not out of the chaotic complexity of a mixture of gases. This transmissible, hereditary, continuous coordination entirely escapes our laws of chance.

Rare fluctuations do not explain qualitative facts; they only enable us to conceive that they are not impossible qualitatively.

Evolution is mathematically impossible

It would be impossible for chance to produce enough beneficial mutations—and just the right ones—to accomplish anything worthwhile.

"Based on probability factors . . any viable DNA strand having over 84 nucleotides cannot be the result of haphazard mutations. At that stage, the probabilities are 1 in 4.80 x 10^50. Such a number, if written out, would read 480,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000,000."
"Mathematicians agree that any requisite number beyond 10^50 has, statistically, a zero probability of occurrence."
I.L. Cohen, Darwin Was Wrong (1984), p. 205.

Nothing sexier than getting pubes the length of spaghetti strands stuck in your throat.

Your video, Russian Sailors Rescue Dog Stranded on Ice Floe, has made it into the Top 15 New Videos listing. Congratulations on your achievement. For your contribution you have been awarded 1 Power Point.

This achievement has earned you your "Pop Star" Level 158 Badge!

It is absurd, but it is also evidently, and provably true. It is a fact. Back in the days of Darwin one could perhaps make the case that the idea of common descent was perhaps stretching it far, but the discovery and later sequencing of DNA makes it a slam dunk. There is no other even remotely reasonable conclusion you can make, but the one that says you are related to a tomato. and elephants, and chimps, and E.Coli and shrimps and everything else that has DNA. Not only do we all share the same basic system (why doesn't some species use different nucleic acids or something else to replicate?) But we share the SAME CODE. Even with our most distant cousins (something like E.Coli) have long strands of DNA code in common with us. The four nucleic acids of DNA , represented by the letters A,T,C and G are laid down by the thousands in patterns like: AAAATTCGGGTATTTATTTGCAAACCTTTT, and then we find the SAME CODE in completely "unrelated" species. But thats not all, the relatedness of the code is excactly what you would expect in the taxonomic tree, and infact it is now THE method for figuring out exactly how related one species is to another, and drawing the correct tree.

So all life IS related, which means it all has a common ancestor, which lived some 3 billion years ago. Which also means it had to be a simple form that diverged into all that we now have. And that process is evolution, and the main driving forceof evolution, by far, is natural selection. So we know that this process happens and that it can create amazing things from really much simpler things. All we need to postulate is the capability to self-replicate for those first replicators. Admittedly, this is pretty hard to envision, but we do know that all the basic building blocks (organic molecules) could arise spontaneously through non-replication. But we may never know exactly how it started, it would be something simple, like some organic molecules spontaneously forming RNA strands, which break in two and each half collects its counter-parts and form two RNA strands and so on...

This guy delivers food and medicine to shipwrecked orphans stranded in Party Cove. This is the only way to do that.

>> ^PancakeMaster:

Step 1: Find puppy
Step 2: Strand puppy on rocks
Step 3: Turn on camera and retrieve said puppy
Step 4: Get laid like a hero


I really wish I wasn't as cynical as you.

I would test it, if I could. By “God”, I’m assuming you’re still talking about Yahweh specifically, and not just any random god-type entity. If that’s the case, then I’ve already falsified the claim that the Bible is perfect, so that argument is gone.

You haven't falsified it. If you have, show me where. If you're referring to Matthews lineage using Chiastic structure, that isn't an imperfection. Chaistic structure is a literary device, so Matthews genealogy is not giving us the entire line, but rather like an artistic summation of it. To say it is wrong would be like telling a painter his painting is wrong.

If you’re merely making a deist claim, then I can’t argue with you. I take no position on deism other than if some deity created the universe and set it in motion, I have no reason to believe it cares about humans, and it certainly has made no edicts that I perceive as to how I should live my life.

Since you have no argument against a potential God, and couldn't tell whether you were living in His Universe or not, then how would you know if this God cares about humans or if it has laid down any edicts about how you should live your life?

You’re not listening to me. Seriously. I do have ways of determining which story is more likely. Occam’s razor is the best for this problem. The complexities introduced by faith in Yahweh and the Bible are necessarily more complex than the problems they solve. They are also blind faith (I'm talking about the vast majority of the faithful, and about what you're recommending I do), which is willful self-delusion. The theories that physicists and biologists have come up with are quite convincing, especially if you understand how science works.

I have been listening to you and what I have found is that if you can find some kind of excuse to dismiss something that seems even potentially legitimate, then you run with it. You only seem interested in trying to falsify the question, because you apparently have already decided it isn't true. You don't have any real evidence to prove it, but in previous conversations you have said you see no reason to bother thinking about it. In short, you don't care.

You say I'm talking about blind faith, and I'm not. I believe what I believe because God convinced me of its truth. I had no reason to believe it otherwise, and I wouldn't. I am telling you that if you draw near to God, He will draw near to you. He loves you and wants you to know Him. You just don't want to know Him and that is the problem.

Neither do you understand the law of parsimony. The law states that in explaining a given phenomenon, we should make as few assumptions as possible. Therefore, if we have two theories which are equal in explanatory power, but one has fewer assumptions, we should choose the one with fewer assumptions. However, a more complex theory with better explanatory power should be chosen over a more simplistic theory with weaker explanatory power. I think John Lennox kind of sums this all up at 3:00



Agreed. I find myself in an environment in which my species was capable of evolving. It says nothing of how statistically improbable it is.

You were created in your parents womb; this says nothing about evolution. It only says that you have some way to come into existence, personally. It says nothing about the particulars of how that came to be.

Disagree. I’m lucky that of all the possible combinations of molecules that could have come together to create our terrestrial environment, the right ones came together to create life, then the right DNA strands combined to eventually create me. I’m lucky, sure, but given the length of time we’ve had, there’s no reason I should be surprised, especially when there's no reason to assert that this is the only universe.

There is no reason to assert it isn't, either. In a finely tuned Universe, it is more plausible to believe it was designed rather than it just happened to be one Universe out of trillions that implausibly just looks like it was designed because if you have enough Universes eventually one will form that appears that way. Remember Occams Razor?

You ask why multiple universes are more likely than a deity? Because you and I both know for sure there is at least one universe, so positing some more of them is less of a stretch than asserting a self-contradictory entity, alien to our objective experience, defying any consistent and meaningful description, so vastly complex that it cannot be properly understood, and so full of human failings that it looks man-made.

That would be true if God were any of those things. I can agree with you though that your understanding of God is self-contradictory, alien to your experience, etc. You believe you have God figured out, when you don't know Him at all. You would actually do anything to know God, but you are rejecting Him out of ignorance.

In the scenario between multiple universes or God as a theory to describe a finely tuned Universe, God wins every time. It doesn't matter how complex God might be; the explanatory power afforded by the theory is by far superior.

I’m sceptical of all your claims because that’s how I roll. I’m sceptical of everything, especially big claims. It’s the smartest way to avoid being duped.

You're skeptical of everything that doesn't agree with your presuppositions about reality. Those I have rarely if ever seen you seriously question in all the time I have spoken to you. Regarding knowledge that agrees with those presuppositions, you feel free to speculate about that all day long and will say that virtually any of it is more plausible with no evidence. The thing is, I used to be on your side of the fence, and I know what a search for the truth looks like. This isn't it.

The smartest way to avoid being duped is to understand that you might be duped at this moment and not realize it. That's the trouble with being deceived; you think you're right when you are really wrong.

You have been telling me that I must believe in the one true thing that is true that is Yahweh and the Bible and creation because it’s true because it’s true because it’s true because it’s the only possibility.

What I've been telling you is that God is not hiding from you. You are hiding from Him. It's not that you don't know there is a God so much as you don't want to know that there is. You simply want to do whatever you think is right and you automatically reject any possibility that says this is wrong and you are in fact accountable to a higher authority. In short, your attitude towards God is not skeptical but rebellious.

Now, I conceive of another possibility: my 10^trillion universes. You agree it’s possible, so there’s no reason for me to believe yours is necessarily true. If I have to choose between them, the one that doesn’t require the further explanation of a sentient deity more complex than 10^trillion universes is simpler. And even then, I DON’T HAVE TO CHOOSE one or the other. I can remain sceptical. To me, it’s foolish not to.

I concede its possible that God could have created other Universes, but I don't concede the idea that Universes just happen by themselves. This is really a very foolish idea. It's like coming across a coke can and believing wind and erosion created it. It only seems plausible to you because you must have a naturalistic explanation for your existence to make sense of your reality.

I don't expect you to believe in God unless He gives you some kind of revelation. I frequently pray that you will receive this revelation, both for you and the sake of your family.

Since I already pointed out this flawed understand of the law of parsimony, I won't reiterate that argument here.

While we’re talking about being honest with ourselves, I’d like to hear it from you that the following things are *at least technically possible*: that Yahweh doesn’t exist; that your relationship with Yahweh is an illusion created by you inside your head because you are human and human minds are prone to occasional spectacular mistakes; that the Bible was created by deluded humans; that the universe is around 14 billion years old; that the Earth is around 4.5 billion years old; that life on Earth started 1-2 billion years ago; and that all species evolved from primitive life forms. To be clear, I’m not asking you to accept them as true or even probable, just state whether this collection of statements is possible or impossible.

This is what Paul said:

1 Corinthians 15:17,19

And if Christ has not been raised, your faith is futile; you are still in your sins.

If in Christ we have hope in this life only, we are of all people most to be pitied.

I wasn't there at the resurrection; I take it on faith. My faith has been borne out by the evidence, such as being born again, witnessing miracles, and experiencing the presence of God in my daily life. I don't admit any of those things; I have most definitely received revelation from God, and there is no other plausible explanation for the evidence. If you can concede that God can give you certain knowledge then you can understand why I don't doubt that knowledge.

Notice what George Wald said?

I notice that you only quote scientists out of context, or when they’re speaking poetically. I guarantee he never said that in a scientific paper. Life may be a wonder, not a miracle.

I *only* do? That's a false generalization. This quote is right on target, and I challenge you to show me where I have taken George out of context. This is what scientists believe, that time + chance makes just about anything possible. Has life ever been observed coming entirely from non living matter? That's a miracle, and that's what you must believe happened either here or somewhere in the Universe.

http://www.pbs.org/wgbh/nova/physics/blog/2012/03/is-the-universe-fine-tuned-for-life/

Near the end, you’ll find this gem: “The history of physics has had that a lot, … Certain quantities have seemed inexplicable and fine-tuned, and once we understand them, they don’t seem to [be] so fine-tuned. We have to have some historical perspective.”

If you haven't done so already, watch the first 10-20 minutes of this: http://videosift.com/video/The-God-of-the-Gaps-Neil-deGrasse-Tyson. It's "creationism/intelligent design" laid bare as a position of weakness. Your "fine tuning" trope is part of "intelligent design" and has the same historical flaw.

It's the God of the gaps argument which is flawed. It's not a God of the gaps argument when the theory is a better explanation for the evidence.

It's just a bare fact that there is a number of physical constants in an extremely narrow range which conspire to create a life permitting Universe. It's even admitted on the wikipedia page:

Physicist Paul Davies has asserted that "There is now broad agreement among physicists and cosmologists that the Universe is in several respects ‘fine-tuned' for life".[2] However he continues "...the conclusion is not so much that the Universe is fine-tuned for life; rather it is fine-tuned for the building blocks and environments that life requires

http://en.wikipedia.org/wiki/Fine-tuned_Universe

What do you mean, “they hate that possibility”? Why should a scientist hate any possibility? If there were science that pointed to the real existence of God, that’s exactly the way their investigations would go. That’s what motivated early modern scientists – they believed unravelling the laws of the universe by experiment would reveal God’s nature. It was only when the scientific path of experimentation split conclusively away from the biblical account that anybody considered that religious faith and scientific endeavour might become separate enterprises.

The roost of the scientific establishment today is ruled by atheistic naturalists, and they very much hate the idea of God polluting their purely naturalistic theories. They consider science to be liberated from religion and they vigorously patrol the borders, expelling anyone who dares to question the established paradigm. A biologist today who questions the fundamentals of evolutionary theory commits professional suicide. It is now conventional wisdom and you either have to get with the program or be completely shut out of the community.

Here are some other interesting quotes for you:

Richard Lewontin “does acknowledge that scientists inescapably rely on ‘rhetorical’ proofs (authority, tradition) for most of what they care about; they depend on theoretical assumptions unprovable by hard science, and their promises are often absurdly overblown … Only the most simple-minded and philosophically naive scientist, of whom there are many, thinks that science is characterized entirely by hard inference and mathematical proofs based on indisputable data

Astrophysicist George F. R. Ellis explains: "People need to be aware that there is a range of models that could explain the observations….For instance, I can construct you a spherically symmetrical universe with Earth at its center, and you cannot disprove it based on observations….You can only exclude it on philosophical grounds. In my view there is absolutely nothing wrong in that. What I want to bring into the open is the fact that we are using philosophical criteria in choosing our models. A lot of cosmology tries to hide that.

As for the “much” stronger evidence, as stated in the article, every time scientists solve a mystery of something they thought was “finely tuned”, they realized that there is a much simpler explanation than God. Evolution, for instance, eliminates the question of "fine tuning" in life. “God” is a metaphor for “things outside my understanding”. Once they move within our understanding, nobody claims that they’re God anymore. And FWIW, some of the most famous scientists ever came to the same "Because God" conclusion, which held until someone else got past it and solved what they couldn't.

I'm glad you understand that the whole enterprise of science was initially driven by the Christian idea that God created an orderly Universe based on laws, and thus we could reason out what was going on by investigating secondary causes. Yet God wasn't a metaphor for something we didn't understand; God was the reason we were interested in trying to understand in the first place, or even thought that we could.

You say there is this "because God" brick wall that we break down by determining the operations of the Universe. We can then see that it was never God at all, but X Y Z, yet what does that prove? Genesis 1 says "God created", and that He controls everything. What you're confusing is mechanism with agency. Can you rule out a clockmaker by explaining how the clock works? That's exactly what you're saying here, and it is an invalid argument.

You also act as if evolution has been indisputably proven. Let me ask you this question, since you claim to understand science so well. What is the proof and evidence that evolution is a fact? Be specific. What clinches it?

So to your conclusion, how do you figure that the appearance of fine tuning—which seems to go away when you look close enough—is stronger evidence?

It only goes away when you come to a series of false conclusions as you have above. The evidence is there, even the scientists admit it. To avoid the conclusion multiple universes are postulated. However, this is even more implausible for this reason; the multiple universe generator would be even more fine tuned than this Universe. Therefore, you are pointing right back at a fine tuner once more.

Eh??? But in your last nine paragraphs, YOU yourself, a limited temporal creature, have been trying to prove God’s existence with your “fine tuning” argument (corrupt reasoning, like you say), even after you've repeatedly asserted in the other threads that the only possible evidence for God is that he’ll answer our prayers. Why are you bothering? It is laughable how inconsistent you’re being here.

I wouldn't know the truth on my own; only God can reveal what the truth is. There are two routes to the truth. One is that you're omnipotent. Another is that an omnipotent being tells you what the truth is. Can you think of any others?

Keep fishing. Either the patient being prayed for recovers or doesn't recover. If not, the sincere prayers weren't answered. Unless you’re suggesting God secretly removed the free will of the scientists and the people praying so that the tests would come back negative? Gimme a break.

You seem to believe that free will means God doesn't interfere in the Creation, and this isn't the case. Free will means, you have the choice to obey or disobey God. It doesn't mean you are free from Gods influences. That's the whole idea of prayer, that God is going to exert His influence on creation to change something. God is directly involved in the affairs of men, He sets up Kingdoms, He takes them away. He put you where He wanted you and He will take you out when He has sovereignly planned to do it.

Even if the prayers are sincere, God isn't going to heal everyone. Yes, either way the patient recovers or doesn't recover, and either way, God isn't going to reveal His existence outside of what He has ordained; faith in His Son Jesus Christ. Anyone trying to prove Gods existence any other way will always come away disappointed.

And all of this was written only after the prophesy was fulfilled. A little too convenient.

Actually it was written hundreds of years before hand.

The 70 weeks are not concurrent, first of all.

I know. I'm assuming they were consecutive. How could 70 weeks be concurrent? That makes no sense at all. Even if you meant to say “not consecutive”, what does it mean to declare a time limit of 70 weeks if they're not consecutive? It means nothing. That time limit could extend to today. What's your source for saying they're not concurrent/consecutive/whatever?

This is why I suggested you become more familiar with theology. Yes, you're right, I meant to say consecutive. You would know they were not consecutive if you read the scripture. The prophecy identifies they are not consecutive. Please see this:

http://www.khouse.org/articles/2004/552/

Again, conveniently, this “prediction” doesn't appear in writing until after the fall of Jerusalem.

Jerusalem fell in 70 AD. The gospels were written beforehand. If they were written afterwards, there would have been a mention of the fall of the city, if only to confirm the prophecy, but there is no mention of it in any of the gospels.

I'll rephrase this by saying, that Jesus fulfilled dozens of prophecies about the coming of the Messiah. Clearly, the impact of that Jesus has had on the world matches His claims about who He is.

Which clearly defined prophecies did he fulfil, not including ones that he knew about and could choose to do (like riding on a donkey)?

http://www.godonthe.net/evidence/messiah.htm

Except for all the religions that aren't Christian. They don’t belong to him, and they have surely had enough time to hear his voice.

The world belongs to Christ. The difference between the Lord and the other religions is this:

1 Chronicles 16:26

For all the gods of the nations are idols, but the LORD made the heavens

You really think that’s unique to Christianity? Do you know much about Islam? And I don't mean Western stereotypes of it. I mean, really know how normal Muslim people live their lives.

Muslims don't have a personal relationship with God. Allah keeps them at arms length, and they mostly serve him out of fear. They also have no idea whether they are going to heaven or not. They only hope that at the end of time their good works will add up more than their bad ones. The reason Muslims choose martyrdom is because under Islam it is the only guaranteed way to go to Heaven.

I get it. It’s a test of sincerity. For whom? Who is going to read and understand the results? To whom is the sincerity proven that didn't know it before, requiring a test? I think you’re avoiding admitting it’s God because that would mean there’s something God doesn't know.

Why do metalworkers purify gold? To remove the dross. That's exactly what God is doing when He tests us:

1 Peter 1:6

In this you greatly rejoice, though now for a little while you may have had to suffer grief in all kinds of trials.

These have come so that your faith--of greater worth than gold, which perishes even though refined by fire--may be proved genuine and may result in praise, glory and honor when Jesus Christ is revealed.

>> ^messenger:

stuff

@shinyblurry

Therefore, the question is, how would you tell if you're in a Universe that God designed?

I would test it, if I could. By “God”, I’m assuming you’re still talking about Yahweh specifically, and not just any random god-type entity. If that’s the case, then I’ve already falsified the claim that the Bible is perfect, so that argument is gone. If you’re merely making a deist claim, then I can’t argue with you. I take no position on deism other than if some deity created the universe and set it in motion, I have no reason to believe it cares about humans, and it certainly has made no edicts that I perceive as to how I should live my life.

The real question is, why is either possibility more or less likely than the other? … leap of faith in favor of your atheistic naturalism... you have to discard your assumptions about what you have seen or haven't seen and think about this on a deeper level.

You’re not listening to me. Seriously. I do have ways of determining which story is more likely. Occam’s razor is the best for this problem. The complexities introduced by faith in Yahweh and the Bible are necessarily more complex than the problems they solve. They are also blind faith (I'm talking about the vast majority of the faithful, and about what you're recommending I do), which is willful self-delusion. The theories that physicists and biologists have come up with are quite convincing, especially if you understand how science works.

A created being should expect to find himself existing in an environment capable of creating him.

Agreed. I find myself in an environment in which my species was capable of evolving. It says nothing of how statistically improbable it is.

In the same way, you should be surprised to find yourself to be a created being in a finely tuned Universe. A finely tuned Universe should tip the scales of that evidence, if you are being honest about what you can really prove.

Disagree. I’m lucky that of all the possible combinations of molecules that could have come together to create our terrestrial environment, the right ones came together to create life, then the right DNA strands combined to eventually create me. I’m lucky, sure, but given the length of time we’ve had, there’s no reason I should be surprised, especially when there's no reason to assert that this is the only universe. You ask why multiple universes are more likely than a deity? Because you and I both know for sure there is at least one universe, so positing some more of them is less of a stretch than asserting a self-contradictory entity, alien to our objective experience, defying any consistent and meaningful description, so vastly complex that it cannot be properly understood, and so full of human failings that it looks man-made.

[me:]… it could be that 10^one trillion universes with different physical properties have formed and collapsed, and when a balanced one finally came out of the mix, it stuck around, and here we are.

[you:] It could be, except there is no evidence there is. Why is it you that can imagine an infinite number of hypothetical Universes with no evidence, but you object to supernatural creation as somehow being less plausible than that.

I’m sceptical of all your claims because that’s how I roll. I’m sceptical of everything, especially big claims. It’s the smartest way to avoid being duped. You have been telling me that I must believe in the one true thing that is true that is Yahweh and the Bible and creation because it’s true because it’s true because it’s true because it’s the only possibility. Now, I conceive of another possibility: my 10^trillion universes. You agree it’s possible, so there’s no reason for me to believe yours is necessarily true. If I have to choose between them, the one that doesn’t require the further explanation of a sentient deity more complex than 10^trillion universes is simpler. And even then, I DON’T HAVE TO CHOOSE one or the other. I can remain sceptical. To me, it’s foolish not to.

While we’re talking about being honest with ourselves, I’d like to hear it from you that the following things are *at least technically possible*: that Yahweh doesn’t exist; that your relationship with Yahweh is an illusion created by you inside your head because you are human and human minds are prone to occasional spectacular mistakes; that the Bible was created by deluded humans; that the universe is around 14 billion years old; that the Earth is around 4.5 billion years old; that life on Earth started 1-2 billion years ago; and that all species evolved from primitive life forms. To be clear, I’m not asking you to accept them as true or even probable, just state whether this collection of statements is possible or impossible.

Notice what George Wald said?

I notice that you only quote scientists out of context, or when they’re speaking poetically. I guarantee he never said that in a scientific paper. Life may be a wonder, not a miracle.

http://www.pbs.org/wgbh/nova/physics/blog/2012/03/is-the-universe-fine-tuned-for-life/

Near the end, you’ll find this gem: “The history of physics has had that a lot, … Certain quantities have seemed inexplicable and fine-tuned, and once we understand them, they don’t seem to [be] so fine-tuned. We have to have some historical perspective.”

If you haven't done so already, watch the first 10-20 minutes of this: http://videosift.com/video/The-God-of-the-Gaps-Neil-deGrasse-Tyson. It's "creationism/intelligent design" laid bare as a position of weakness. Your "fine tuning" trope is part of "intelligent design" and has the same historical flaw.

They acknowledge there are only two possibilities, one being God, but since they hate that possibility more than they hate embracing the anthropic principle, they go with that instead, having absolutely no evidence to base that conclusion on. They simply don't want to acknowledge the obvious, which is that a finely tuned Universe is *much* stronger evidence for an omnipotent God than it is for multiple Universes.

What do you mean, “they hate that possibility”? Why should a scientist hate any possibility? If there were science that pointed to the real existence of God, that’s exactly the way their investigations would go. That’s what motivated early modern scientists – they believed unravelling the laws of the universe by experiment would reveal God’s nature. It was only when the scientific path of experimentation split conclusively away from the biblical account that anybody considered that religious faith and scientific endeavour might become separate enterprises.

As for the “much” stronger evidence, as stated in the article, every time scientists solve a mystery of something they thought was “finely tuned”, they realized that there is a much simpler explanation than God. Evolution, for instance, eliminates the question of "fine tuning" in life. “God” is a metaphor for “things outside my understanding”. Once they move within our understanding, nobody claims that they’re God anymore. And FWIW, some of the most famous scientists ever came to the same "Because God" conclusion, which held until someone else got past it and solved what they couldn't.

So to your conclusion, how do you figure that the appearance of fine tuning—which seems to go away when you look close enough—is stronger evidence? What is your rationale for the weighting so strongly in favour of God? Couldn't it be that we simply don’t know yet how the universe came to be the way it is? To me, that’s actually the most likely scenario, since that’s what’s happened with so many other erroneous theological claims, including by some of science’s greatest minds ever.

A limited temporal creature, trying to disprove Gods existence with his own corrupt reasoning is kind of laughable, isn't it?

Eh??? But in your last nine paragraphs, YOU yourself, a limited temporal creature, have been trying to prove God’s existence with your “fine tuning” argument (corrupt reasoning, like you say), even after you've repeatedly asserted in the other threads that the only possible evidence for God is that he’ll answer our prayers. Why are you bothering? It is laughable how inconsistent you’re being here.

Or perhaps He had sovereignly arranged for only insincere prayers or prayers outside of His will to be prayed for at that time which would give the results of the test the appearance of randomness.

Keep fishing. Either the patient being prayed for recovers or doesn't recover. If not, the sincere prayers weren't answered. Unless you’re suggesting God secretly removed the free will of the scientists and the people praying so that the tests would come back negative? Gimme a break.

The Jews are historically from Israel, and there is archaeological evidence to prove this. The reason they came back to Israel is because it is historically their homeland. Given the opportunity, they would have come back to Israel with or without the bible saying they were entitled to. The point is that they were predicted to come back, not only around the date that they did, but their migration pattern was in the exact order, their currency was predicted, their economic and agricultural condition was predicted, and many other things.

And all of this was written only after the prophesy was fulfilled. A little too convenient.

The 70 weeks are not concurrent, first of all.

I know. I'm assuming they were consecutive. How could 70 weeks be concurrent? That makes no sense at all. Even if you meant to say “not consecutive”, what does it mean to declare a time limit of 70 weeks if they're not consecutive? It means nothing. That time limit could extend to today. What's your source for saying they're not concurrent/consecutive/whatever?

Second, Jesus is the one who predicted the fall of Jerusalem:

Again, conveniently, this “prediction” doesn't appear in writing until after the fall of Jerusalem.

I'll rephrase this by saying, that Jesus fulfilled dozens of prophecies about the coming of the Messiah. Clearly, the impact of that Jesus has had on the world matches His claims about who He is.

Which clearly defined prophecies did he fulfil, not including ones that he knew about and could choose to do (like riding on a donkey)?

Christ speaks, however, and from that moment all generations belong to him.

Except for all the religions that aren't Christian. They don’t belong to him, and they have surely had enough time to hear his voice.

The other founders of religions had not the least conception of this mystic love which forms the essence of Christianity.

You really think that’s unique to Christianity? Do you know much about Islam? And I don't mean Western stereotypes of it. I mean, really know how normal Muslim people live their lives.

The metaphor that is used for testing is that of impurities being refined out of gold or silver. Tests are to prove your sincerity, not necessarily what God knows.

I get it. It’s a test of sincerity. For whom? Who is going to read and understand the results? To whom is the sincerity proven that didn't know it before, requiring a test? I think you’re avoiding admitting it’s God because that would mean there’s something God doesn't know.

Poor Brit, he's been stranded on Monster Island.

to be fair, he also refuses to sail over the horizon for safety reasons. wouldn't want to get stranded among the turtles.

The rules for this should have required at least a token check of the inner surface of the tire. Unless you know you got snakebit (puncture caused by hitting a curb with underinflated tires), changing a flat without inspecting the inner surface is a waste of time and tubes.

There should also be a patch kit time trial. I can do it in under 10 mins in real conditions, and I'm sure others can do it in under 5.>> ^Tojja:

- 30 seconds spent identifying/removing source of puncture (glass/wire/thorn) saves many minutes of rework when you get another puncture a minute later from the bastard wire strand you didnt look hard enough for

Yeah, he used a CO2 canister-based pump. Very handy for quick changes, but you need to be careful to do as he do and aim upwards when inflating (downward facing = greater chance of freezing inner tube - from experience). Note: Depending on temperatures and canister size (12g, 16g etc), CO2 canisters often only get you back up to 80-90PSI, which may or may not be enough for your setup


This was a great (and impressive) display. As someone who has changed HUNDREDS of flatties, my ramblings, FWIW:
- The tyre/rim combo can often mean removal (and reseating) of the tyre is a PITA, due to slightly small ID tyre bead and slightly oversize RIM OD. Inevitably this requires n+1 tyre levers, with n being the number you have in your pocket (tip: wheel quick releases make good emergency tyre levers at a pinch)
- 30 seconds spent identifying/removing source of puncture (glass/wire/thorn) saves many minutes of rework when you get another puncture a minute later from the bastard wire strand you didnt look hard enough for
- always carry a patch kit (or 1-2 of the self-adhesive sticky instant patches). Two punctures on one ride is rare but it happens and being stranded out of cell coverage then trying to peel off bar tape to seal a puncture is a way to ruin a good ride
- Replace old tyres. There is an exponential growth curve that describes the relationship between tyre age to incidence of punctures. Old tyres are the single most effective way to spend lots of time on the side of the road yelling

That wasn't meant to be a comprehensive explanation of everything wrong with the ending, just one part. (MASSIVE spoilers to follow)

Also, when you say "Reapers prune only the few most advanced species in order to save less advanced organic life", save them from what, exactly? Synthetics? And Reapers are what, exactly? Synthetics?

Aside from the circular reasoning, it's also based on a premise that is at the very least debatable: the created will always rebel against their creators. I got to that conversation having brokered peace between the Geth and the Quarrians. Why wasn't it even an option for Shepard to question whether this was some iron law of the universe? Why is the Catalyst assuming peace between organics and synthetics is impossible? Why was it impossible for any ending to leave the Geth and Quarians both physically the same, and independent? Why wasn't it possible for Shepard to be annoyed about this?

Moreover, why kill organics to prevent robot uprisings? Why not have reapers wipe out synthetic races if/when they start to rebel, rather than wiping out organics before they can build synthetics?

If the Reapers are really saviors of the galaxy, why do they shoot first and ask questions never? If being converted into a husk is really a form of ascension, why not try to convince races to volunteer? Why not stick around for thousands of years to persuade us, if necessary? For that matter, why make this be some sort of every 50K year thing? Why not just make ascension into Reaper form a part of galactic culture, a reward given to races who've advanced far enough to warrant it?

But my biggest problem is that we don't really get to see any kind of real consequence of that final choice. All three endings are virtually indistinguishable, and there's nothing about the ending that reflects the choices you've made along the way, not even the ones from ME3. There's no real resolution for any of your crewmates either. I'd like to know what happens to Garrus, Liara, Tali, etc. after it's all over. "Stranded on a strange jungle planet" wasn't what I was looking for, either.

>> ^mentality:

>> ^NetRunner:
http://markel.files.wordpress.com/2012/03/f3p6x.jpg

That's stupid. Reapers prune only the few most advanced species in order to save less advanced organic life throughout the galaxy. Sounds like whoever made that was dozing off during the conversations with the catalyst.