Thankfully his cousin Viktor Splooge had no hand in the creation of said apparatus.

Actually, that's exactly what I say, and average modern human morality is considerably superior to the filth that the biblical God advocates.

The moral standard of western civilization is founded upon judeo-christian beliefs. Read:

http://www.amazon.com/Book-that-Made-Your-World/dp/1595555455/ref=sr_1_1?ie=UTF8&qid=1366921071&sr=8-1&keywords=book+that+made+your+world

Following the morality the biblical God advocates is the hardest thing you will ever do. The standard of today is a superficial, politically correct morality where you pretend to be nice to people but curse them when they aren't around. God requires a transformation on the inside where you have genuine love for your fellow man.

I am only saying that they are wrong by todays generally agreed upon moral standards. Some of these moral standards are extremely effective and have been around since very early human communities, so they only have the illusion of being absolute due to high adherence rate.

Are you saying nigh universal adherence to certain moral standards isn't evidence for an absolute standard of morality?

Murder, theft, oppression and incest are three fairly obvious examples. The evolutionarily advantageous trait of society building tends to list it's effectiveness when such things are widespread. But we have a very long human tradition of sanctioning and celebrating murder and theft as long as it occurs well outside our cohort. Killing other tribes is celebrated in the bible, as is stealing their possessions. Ethically justified slavery took another 4000 years to mostly get rid of, and hell, it was common practice to fuck your fifteen year old cousin all the way up to about the late 1800s here in the good old US of A as long as it was under the marital auspices of the church, of course.

Yep, but thank God that his just definition of morality - if we didn't have god's guidance through scripture, we'd probably do crazy shit!

You don't understand what God was doing in the Old Testament, or why He did it the way He did. It is morally consistent with His goodness and holiness, and there are logical reasons for why this is so. So far you are not interested in hearing them or discussing them. When you are let me know. In the end you don't have any excuse for suppressing the truth about Jesus, no matter what you think about how God acted in the Old Testament.

Using the word 'absolute' is a concession to brevity, but nice try - seriously dude, this is laughable and it wouldn't even stand up in Jr. High debate - absolutes do exist, they just need to be well justified, and yes if you want to be nitpicky about it there is an ever so remote chance that 1+1 is not equal to two in some distant corner of the universe. But as humans with an admittedly limited scope of understanding, we have to accept that level of certainty. If you want to relegate your theory to claiming its space somewhere in the possibility that we might be wrong about the whole 2+2=4 thing, go right on ahead.

There, that's what I meant by absolute. happy?

Basically, what you're saying is that because 2+2 probably equals four everywhere in the Universe, you are free to make absolute statements about morality? The fact is that your belief system leaves you with no justification for any absolute statement what so ever. Why should 2 + 2 always equal 4 in the first place? Can you tell me why the laws of physics should work in the same way 5 seconds from now without using circular reasoning?

Can you justify any piece of knowledge without God? If you can then tell me one thing you know and how you know it. Could you be wrong about everything you know?

Well then thanks for the offer, but I think I'll pass in the whole god based morality thing. I prefer to have a really good reason to never slaughter innocent kids. But thanks for finally answering my question: there has been a good reason to butcher a toddler after all! Praise The Lord, for he is good!

It comes back to the same question: As the giver of life, and the adjudicator of His Creation, is it wrong for God to take life?

And here's another interesting brain tickler. If everything god commands is right, and god has a track record of testing his faithful with their willingness to commit infanticide, how can you say that this lady isn't moral?

http://articles.sun-sentinel.com/2001-08-17/news/0108170166_1_baby-s-death-baby-s-father-documents

The scripture is finished and anything which contradicts it is not of God.

Wrong, I know that things are wrong because humans and cultures have a long history of interacting with reality, and certain strategies have been more successful than others. You haven't spent one iota of your time discrediting this notion, whereas I have given you plenty of examples crediting mine and discrediting yours.

What I am supposed to be discrediting? You're asking me to nail jello to a wall. You have not even defined what "successful" is supposed to mean beyond pure survival. In that case, every civilization has been successful. Tell me what your definition of success is supposed to be.

For the millionth time, I have no hopes of convincing you of anything - you'll defend your stance against literally any proof. But you seem to come here on the sift with the intent of demonstrating to others that there is some logical basis for your beliefs.

What proof? The foundation of atheism stands upon the shifting sands of relative truth. You, the atheist, ultimately make yourself the measure of all truth. Because of that, you can't tell me a single fact about the world that you can justify.

Well you're failing miserably, mainly because you are only capable of restating the following sentence as if it is an agreed upon truth:

"Not only is the entire concept logically contradictory, but it doesn't match our experience, which is that some things are absolutely wrong. "

I don't expect you to have any good support for that, but the audience out there just waiting to be convinced, they will need at least something.

Torturing babies for fun; not absolutely wrong?

I'm still waiting for you to give Stalin some kind, any kind of argument as to why he should adopt your morality and abandon his own. If you can't tell Stalin why he is wrong, then you have no hope of escaping the charge of incoherency.

"... If people rob and cheat you, you don't say that they are just executing their particular survival strategy, you say that those things are wrong. You know they are wrong because you have a God given conscience which tells you that they are. "

Actually, that's exactly what I say, and average modern human morality is considerably superior to the filth that the biblical God advocates.

I am only saying that they are wrong by todays generally agreed upon moral standards. Some of these moral standards are extremely effective and have been around since very early human communities, so they only have the illusion of being absolute due to high adherence rate.

Murder, theft, oppression and incest are three fairly obvious examples. The evolutionarily advantageous trait of society building tends to list it's effectiveness when such things are widespread. But we have a very long human tradition of sanctioning and celebrating murder and theft as long as it occurs well outside our cohort. Killing other tribes is celebrated in the bible, as is stealing their possessions. Ethically justified slavery took another 4000 years to mostly get rid of, and hell, it was common practice to fuck your fifteen year old cousin all the way up to about the late 1800s here in the good old US of A as long as it was under the marital auspices of the church, of course.

Yep, but thank God that his just definition of morality - if we didn't have god's guidance through scripture, we'd probably do crazy shit!

Do you see that these are absolute statements? On what grounds do you say there is no absolute morality? Saying there are no rules is a rule; this statement contradicts itself

Using the word 'absolute' is a concession to brevity, but nice try - seriously dude, this is laughable and it wouldn't even stand up in Jr. High debate - absolutes do exist, they just need to be well justified, and yes if you want to be nitpicky about it there is an ever so remote chance that 1+1 is not equal to two in some distant corner of the universe. But as humans with an admittedly limited scope of understanding, we have to accept that level of certainty. If you want to relegate your theory to claiming its space somewhere in the possibility that we might be wrong about the whole 2+2=4 thing, go right on ahead.

There, that's what I meant by absolute. happy?

When God issued the command to wipe out Canaan, it would have been immoral for the Israelites to disobey Him.

Well then thanks for the offer, but I think I'll pass in the whole god based morality thing. I prefer to have a really good reason to never slaughter innocent kids. But thanks for finally answering my question: there has been a good reason to butcher a toddler after all! Praise The Lord, for he is good!

I love Futurama, but I rather see it stop now then descend into mediocrity like's it's yellow skinned cousin.

Things should be allowed to die gracefully.

Aww man!??....That was my cousin-

Awwww dude!?? That's my cousin!!

Well, that was different. Stay out of Fresno, I guess. And he's not a hippie: he's a surfer. They're cousins.

Look, I may seem like a cynic here, but I'm a real softy when it comes to kids, and they say cute, funny stuff all the time. My point is that this chainmail is fake. Kids didnt say this stuff, its just garbage thats passed around. And that counts, to me, because if this is just stuff a 40 year old man has made up, then the quotes arent cute at all, and theres no point in going "Aaawwww thats so cuteycutecute of all those toddlers saying that! I dont know where they come up with it!!" Well "they" didnt. They dont even exist, these kids.

Passing around unsourced cute "facts" like this is a stupid meme on the net that should be stomped out. Fine, this one is completely harmless, but they arent all like that. like just the other day I saw this bullshit about how you can die from drinking straight from a soda can, supported by some anectdotal sob-story about someone who knew someones dad's cousin it really happened to.

The same method is frequently used to spread garbage about vaccines and actual medicine and promoting hogwash.

Bottom line: I dont find stuff that imaginary kids said cute.

It is absurd, but it is also evidently, and provably true. It is a fact. Back in the days of Darwin one could perhaps make the case that the idea of common descent was perhaps stretching it far, but the discovery and later sequencing of DNA makes it a slam dunk. There is no other even remotely reasonable conclusion you can make, but the one that says you are related to a tomato. and elephants, and chimps, and E.Coli and shrimps and everything else that has DNA. Not only do we all share the same basic system (why doesn't some species use different nucleic acids or something else to replicate?) But we share the SAME CODE. Even with our most distant cousins (something like E.Coli) have long strands of DNA code in common with us. The four nucleic acids of DNA , represented by the letters A,T,C and G are laid down by the thousands in patterns like: AAAATTCGGGTATTTATTTGCAAACCTTTT, and then we find the SAME CODE in completely "unrelated" species. But thats not all, the relatedness of the code is excactly what you would expect in the taxonomic tree, and infact it is now THE method for figuring out exactly how related one species is to another, and drawing the correct tree.

So all life IS related, which means it all has a common ancestor, which lived some 3 billion years ago. Which also means it had to be a simple form that diverged into all that we now have. And that process is evolution, and the main driving forceof evolution, by far, is natural selection. So we know that this process happens and that it can create amazing things from really much simpler things. All we need to postulate is the capability to self-replicate for those first replicators. Admittedly, this is pretty hard to envision, but we do know that all the basic building blocks (organic molecules) could arise spontaneously through non-replication. But we may never know exactly how it started, it would be something simple, like some organic molecules spontaneously forming RNA strands, which break in two and each half collects its counter-parts and form two RNA strands and so on...

Cousin to the baby snatching Eagle?

This is correct for the most part. Their venom contains sphingomyelinase D which is the same necrotic agent that their cousin spiders, the recluses, have made so infamous.

Comment hidden because you are ignoring dag. (show it anyway)

Best Book: Wool. If you like your dystopian post-apocalyptic SF - this is the one.

Best Movie: I enjoyed Argo, Looper and Cloud Atlas - though in general I think this was a poor year for the kinds of films I like.

Best game: As a casual gamer, dare I say, Bad Piggies? ;-)

TV: Will second Breaking Bad - I've actually gotten in to the final season of Merlin with the kids. Also, Season 2 of Game of Thrones and season 3 of Downton. Poor Cousin Matthew!

Music: This year has been a year of nostalgia - I'm listening to almost no new music except the latest from Kate Havnevik.

I can't even begin to figure out what she was doing. Was she trying to park across more than one spot? Perhaps she's cousins with this lady: http://videosift.com/video/Spanish-Woman-Cant-Get-HUGE-Car-Into-Little-Parking-Spot

*promote

The girl reminds me of my wife's cousin

Oooah, oooah,
Oooah, oooah,
Oooah, oooah,
Oooah...

[Now I lay me down to sleep... ! ]

Do you wanna dance?
Do you wanna fight?
Do you wanna get drunk and stay the night?

{{Knowing what's the price of me/leave?}}

Do you wanna dance?
Do you wanna fight?
Do you wanna get drunk and stay the night?
Do you wanna smoke till our throats are sore?
Make out and then talk and then make out some more?
Do you wanna dance?
Do you wanna fight?
Do you get drunk and stay the night?
Do you wanna know all the things I do
Where I'm all alone and thinking about you?
Do you wanna?
Do you wanna?
Do you wanna?
Do you wanna?
Do you?
Do you?
Do you?
Do you?
Do you?
Do you?
Do you?
Do it!

Do you wanna go back home?
Your animals are all alone
And there's a chicken waiting on the stove
And your cousin left his DVD of "Swinging In The 70s"
And do you wanna go back home?
Check your messages and charge your phone
Oh are you, really sure you wanna go?
When you could do it with a rock star, do it with a rock star?

Wait, wait, wait!
I'll be fine in a minute
Oh, oh oh
Wait, wait, wait!
I'll be fine in a minute
Fine in a minute

I don't want your body just a part to listen to INXS
All the practice in the world
Won't get me good at loneliness-less
Loneliness-less, loneliness-less-less-less-less

Do you wanna dance?
Do you wanna fight?
Do you wanna get drunk and stay the night?
Do you want to see all my cavities?
Talk about the crisis in the Middle East?
Do you wanna get really terrified?
Th'icecaps are all melting and we're gonna die
Do you wanna cry?
I can make you cry
Do you wanna hit me baby one more time?
Do you wanna?
Do you wanna?
Do you wanna?
Do you wanna?
Do you?
Do you?
Do you?
Do you?
Do you?
Do you?
Do you?
Do it!

Do you wanna go back home?
Your animals are all alone
And there's a chicken waiting on the stove
And your cousin left his DVD of "Swinging In The 70s"

And do you wanna go back home?
Check your messages and charge your phone
Oh are you, really sure you wanna go?
When you could do it with a rock star, do it with a rock star?

Wait, wait, wait!
I'll be fine in a minute
Oh, oh oh
Wait, wait, wait!
I'll be fine in a minute
Wait, wait, wait! (Do you wanna go back home?)
I'll be fine in a minute
Oh, oh oh
Wait, wait, wait! (Do you wanna go back home?)
I'll be fine in a minute
Fine in a minute
Fine in a minute
Fine in a minute
Fine in a minute
Fine in a minute
Fine in a minute
Fine in a minute
Fine in a minute
Fine in a