search results matching tag: this that and everything else
» channel: nordic
go advanced with your query
Search took 0.017 seconds
Videos (12) | Sift Talk (3) | Blogs (0) | Comments (121) |
Videos (12) | Sift Talk (3) | Blogs (0) | Comments (121) |
Not yet a member? No problem!
Sign-up just takes a second.
Forgot your password?
Recover it now.
Already signed up?
Log in now.
Forgot your password?
Recover it now.
Not yet a member? No problem!
Sign-up just takes a second.
Remember your password?
Log in now.
Canada creates Gayest video ever
You have to know it's not going to 'settle' any time soon. Actually, it's not going to 'end', ever.
Underneath the hatred and everything else, this issue hits into the bedrock questions around free will. What actions and behaviors do we 'count' as ones that people had the free will to choose or not choose? We have crowds vehemently entrenched on both extremes of everything and nothing. How we should structure our social contracts, rules and laws to be 'fair' in that context is going to be an argument for all eternity I fear.
OK, I'll be the devils advocate and say; Are ads like these necessary? Don't ads like these make the homophobes react with; "See, they are now promoting being gay." My question is; Who are these ads directed at? Being "gay" is totally accepted by right minded, 21st century individuals so, it would seem, ads like these are directed at the homophobes which, surely, is self defeating. If I don't like something, seeing an ad will certainly not change my mind.
Teen Playing the Knockout Game Gets Shot Twice by Victim
"I see a connection between this feeling of powerlessness and the "stop and frisk" laws."
If we were science-minded, we'd demand statistics to confirm that hypothesis. And we'd look for data showing that removing "stop and frisk" reduces crime. But it's likely the opposite... "stop and frisk" works, and removing it increases crime.
The reason there's a correlation between cities with "stop and frisk" and the "knockout game" is because these cities passed "stop and frisk" in response to their unhinged urban youth violence.
These kids feel powerless because their academic scores are the level of third-worlders. Fix that, and everything else will fix itself.
I've been watching a lot about the knockout game as of late. It really does seem to be a hate crime (It's also called Polar Bearing, because it's victims tend to be white). It's caused quite a stir in the black community, as those who know better seem to be cringing and distancing themselves from the attacks as well as possible.
Ultimately, it's the fault of a few individuals who feel powerless enough in their own lives to try to take it out on others. I see a connection between this feeling of powerlessness and the "stop and frisk" laws passed in many of the cities where the knockout game first became popular.
I think the solution to this kind of violence is improving police relations with the affected communities. The first step is getting rid of "stop and frisk", the second removal of police arrest quotas, the third would be reducing the black prison population's non-violent offenders.
Fantastic Toy Commercial For Future Girl Engineers
Girls.
You think you know what we want, girls.
Pink and pretty it's girls.
Just like the 50's it's girls.
You like to buy us pink toys
and everything else is for boys
and you can always get us dolls
and we'll grow up like them... false.
It's time to change.
We deserve to see a range.
'Cause all our toys look just the same
and we would like to use our brains.
We are all more than princess maids.
Girls to build the spaceship,
Girls to code the new app,
Girls to grow up knowing
they can engineer that.
Girls.
That's all we really need is Girls.
To bring us up to speed it's Girls.
Our opportunity is Girls.
Don't underestimate Girls.
Obamacre Navigators Exposed Coaching Applicants to Lie
Hey Republicans. Don't forget, you invented the individual mandate. You tried to pass it into Federal law many times yourself. Don't be all ticked off just because some black guy finally did what you couldn't. Typical move the goal post behavior. What's changed since the Republican version that was endorsed by the insurance industry? Let's see... they now need to cover pre-existing conditions, yeah, that's horrible, making insurance companies cover sick people and not charge them more, how horrible... and they changed it from catastrophic coverage to comprehensive coverage, so now the insurance companies have to pay for far more services... hmm... I wonder why Republicans suddenly oppose their own idea? Perhaps because suddenly there is less profit in the suffering of millions of people? That is all that matters to Republicans, profit over people. To undue the damage caused by unions in giving people 40 hour work weeks and make people work 80+ hours a week again so that the fat rich cats can keep more and more of the limited resource called money... so that nice little income gap can continue to grow. Hey, perhaps someday soon the US will be like the old Soviet Union with long bread lines, the Republicans clearly want to see that. After all hundreds of them chanted "Let them die!" at the Republican debate... that was the moment that I decided even if I got my faith in god back, I'd rather be in hell then in heaven with people like that, apparently they forgot all the teachings of Jesus about how the rich can't get into heaven, how to help the needy and the poor, how to be lovers of peace and not war, how love was the greatest commandment, and everything else that the Republican party is opposed to.
I don't get why people get upset at the keep the insurance plan. It isn't the government shutting it down, it is greedy insurance companies shutting it down. It's like jobs going to China, people get mad at the government rather than the rich ass hole who sent the jobs oversees so his own personal profits could be higher. I seem to recall the people who are complaining, defended oil company profits by pointing out that per dollar earned/gross profit margin oil was down at 17 or so, while banks were number one followed by a small gap, pharmaceuticals were number two and insurance number three with a nice gap to number 4 and on to the rest of the list. So yeah, if changes in how they have to cover people means they might fall off that list of top 3 most profitable bushiness, then I would expect them to drop the less profitable plans to maintain their multi-billion dollar profit off the suffering of others so a few rich people can have a nice cozy life while millions suffer for their greedy gains.
Health insurance shouldn't be about huge profits. It should be about getting people the health coverage they need... of course I could also argue that the health care industry as a whole shouldn't be so profit driven... nor should the education required to train our healthcare workforce (nor education at all really)... We should have gotten what Obama promised in the first place, a single payer system, or at the very least a Government Option, rather than caving into the Republican Right and turning the money over to a multi-billion dollar industry... and now look, they still oppose it even though it was their idea... If they were going to oppose it no matter what, he should have made it worth everyone's while and given actual reform.
And hey, if you oppose it, come up with something better. Something that will help the millions of people working at places like retail and fast food that can't get employer sponsored coverage. Make sure every American is covered and can afford health care, not emergency treatment, but going to see a doctor for preventative care and affording any medication that the doctor may prescribe.
Super Clever Sunglass Illusion
They weren't using an "special" effects, they simply told the camera to only focus on what is in the center of the lens. So when the camera looked at the top of the "object" it would focus to the very back of the piece of paper and everything else would be out of focus. Move to the bottom of the piece of paper and the top goes out of focus.
I actually guessed the entire desk was a picture at the end, but for a much different reason. When it zoomed on the sunglasses I at first thought nothing of the scene was 2d because the shine on the glasses would be hard to do on a matte, and mainly because all shadows were correct. Then I thought "wait.. what if everything was a picture?" and she pulled the desktop off. So it was more a deductive reasoning and not because I saw anything.
Dr Apologizes for Being SO WRONG About Medical Marijuana
No matter how many years have passed, i've never understood what is the point of getting rid of all mind altering substances in your life? I understand that there re some that don't like it but why do they have to insist that their way is the only one? Everything in moderation of course, not suggesting we should be "loaded" 24/7. I feel that it's religious reasons that makes our society say "sobriety is a virtue" and everything else is a sin. I hear those monks do make great beer thou
The Bible is Not the Word of God
Your problem is that you confuse the world with what people do. The things people do are the shields against the forces that surround us; what we do as people gives us comfort and makes us feel safe; what people do is rightfully very important, but only as a shield. We never learn that the things we do as people are only shields and we let them dominate and topple our lives. In fact I could say that for mankind, what people do is greater and more important than the world itself.
The world is all that is encased here; life, death, people, the allies, and everything else that surrounds us. The world is incomprehensible. We won't ever understand it; we won't ever unravel its secrets. Thus we must treat it as it is, a sheer mystery!
An average man doesn't do this, though. The world is never a mystery for him, and when he arrives at old age he is convinced he has nothing more to live for. An old man has not exhausted the world. He has exhausted only what people do. But in his stupid confusion he believes that the world has no more mysteries for him. What a wretched price to pay for our shields!
A warrior is aware of this confusion and learns to treat things properly. The things that people do cannot under any conditions be more important than the world. And thus a warrior treats the world as an endless mystery and what people do as an endless folly.
- castaneda
Creationist Senator Can E. Coli Turn Into a Person?
It is absurd, but it is also evidently, and provably true. It is a fact. Back in the days of Darwin one could perhaps make the case that the idea of common descent was perhaps stretching it far, but the discovery and later sequencing of DNA makes it a slam dunk. There is no other even remotely reasonable conclusion you can make, but the one that says you are related to a tomato. and elephants, and chimps, and E.Coli and shrimps and everything else that has DNA. Not only do we all share the same basic system (why doesn't some species use different nucleic acids or something else to replicate?) But we share the SAME CODE. Even with our most distant cousins (something like E.Coli) have long strands of DNA code in common with us. The four nucleic acids of DNA , represented by the letters A,T,C and G are laid down by the thousands in patterns like: AAAATTCGGGTATTTATTTGCAAACCTTTT, and then we find the SAME CODE in completely "unrelated" species. But thats not all, the relatedness of the code is excactly what you would expect in the taxonomic tree, and infact it is now THE method for figuring out exactly how related one species is to another, and drawing the correct tree.
So all life IS related, which means it all has a common ancestor, which lived some 3 billion years ago. Which also means it had to be a simple form that diverged into all that we now have. And that process is evolution, and the main driving forceof evolution, by far, is natural selection. So we know that this process happens and that it can create amazing things from really much simpler things. All we need to postulate is the capability to self-replicate for those first replicators. Admittedly, this is pretty hard to envision, but we do know that all the basic building blocks (organic molecules) could arise spontaneously through non-replication. But we may never know exactly how it started, it would be something simple, like some organic molecules spontaneously forming RNA strands, which break in two and each half collects its counter-parts and form two RNA strands and so on...
Evolution is real. However to imply or believe that all things evolved from the utter basic building blocks to what we have today is absurd.
Ben Stein Stuns Fox & Friends By Disagreeing With Party Line
>> ^shinyblurry:
>> ^RFlagg:
Problem is, they say the reason we were doing better was because we had God in schools, then we took him out of the schools and everything else... everything comes to how god was involved back then and less so now therefore we are paying the punishment of not having god in our lives... never mind how well many of the more atheist countries are doing (they think atheist countries are more like the old USSR)...
>> ^Fairbs:
Something most Republicans can't grasp is our country is better off when the rich are taxed more. 40 years ago, taxes on capital gains were 80%, but now Romney feels he's taxed too much at 15.
The argument isn't really about countries that are more atheist versus countries that aren't. It's that the United States has uniquely been a Christian nation since its founding. We are one nation, under God. Most people don't understand what that means; they think it is archaic when it is really the most important founding principle we have. The rapid decline in civil society has to do with the fact that, for the first time generations of Americans are growing up without the judeo-christian ethic being instilled in them from society, especially from their schools. And what we've seen since 1963 is a dramatic increase in the rate of violent crimes, teen pregnancy, STDs, the divorce rate, broken families, drug use, etc..the list goes on. There are the top 7 problems we had in our schools according to government records in 1940 vs 1990:
1940
1. Talking out of turn
2. Chewing Gum
3. Making noise
4. Running in the Halls
5. Cutting in Line
6. Dress-code violations
7. Littering
1990
1. Drug abuse
2. Alcohol abuse
3. Pregnancy
4. Suicide
5. Rape
6. Robbery
7. Assault
So, the argument is really that, we as a society have collectively turned our back on God, and therefore God has also turned His back on us. The principle is, you reap what you sow, and that's exactly what is going on right now. That's why this nation is facing calamity after calamity, because we have lost our way and we refuse to repent and turn back to our Creator.
You are picking and choosing your details man. I think you are also getting your 'facts' about the 40's and 50's from tv shows and movies and using them to spin your idea of 'how golden and free of crime America was before we turned out back on God.' And what about the decades before the 50's, certainly we hadn't 'turned away from god', so how do you explain the debauchery of the 20's, the turn of the century 'robber barons' that lived in luxury while their sweat-shops were worked by the masses of poor and children. The herione gangs and the waves of violence around 1910, 15.
It is really funny how some people (mostly white, older and male) see the 40's and 50's as this shining era of godly love, no crime and family harmony. It was all like 'leave it to beaver'. Dad made the big bucks, mom stayed at home and the most the kids ever got into trouble was when they broke a neighbors window. Yes, generally crime rates were low in the 40's and 50's but you cant attribute that to people 'having the fear of god' back then but skip over times that had just as much, if not even more religious fervor but also plenty of social upheaval and crime. Point of fact crime rates right now in most states are at historical lows, nearly to the levels of the 50's, but you still see murders every day. The information age has changed these things. In the 50's the only news you had was local. You might never have heard about some crime rave in another state.
Other things can attribute to the lower crime rates of those years. How many young men were serving in WWII during the 40's, that certainly would account for a drop in crime rates. And as to the 50's, the threat of nuclear war was constant. 'In God We Trust' wasn't added to money in the mid 50's because it was a particularly religious era, but rather because if the threat of communism. The term used to denote a healthy and proper family in the 50's wasn't coined the 'nuclear' family for nothing.
Last I'd like to point out that the US was 'never' designed as a Christian Nation and has only receive that monicker in the last number of years. I know bible-thumpers and hard-right politicians would have you think, hell have even changed school books, to wipe out ideas like the simple fact that many of the founding fathers wanted nothing to do with religion, though certainly not all. You can twist the words of John Adams, Benjamin Franklin or Thomas Jefferson all you want, but they above all abhorred the idea of religion influencing politics. This is not to say that they were all anti-religion, many advocated religion as a personal foundation of morality, but to hear modern republicans suggest they wanted Christianity to be the basis of the constitution and this country, they would be rolling over in their graves.
Ben Stein Stuns Fox & Friends By Disagreeing With Party Line
I know an older Christian that I greatly respect who blames the recent collapse of conservatism on the fundamentalist takeover of the Southern Baptist Convention. He was in seminary school when it happened. The fundamentalists moved in and started a wave of ideological contraction that has become the basis for the social side of modern neo-conservatism.
In that regard I blame fundamental Christianity for the general stupidification of the US.>> ^RFlagg:
Problem is, they say the reason we were doing better was because we had God in schools, then we took him out of the schools and everything else... everything comes to how god was involved back then and less so now therefore we are paying the punishment of not having god in our lives... never mind how well many of the more atheist countries are doing (they think atheist countries are more like the old USSR)...
>> ^Fairbs:
Something most Republicans can't grasp is our country is better off when the rich are taxed more. 40 years ago, taxes on capital gains were 80%, but now Romney feels he's taxed too much at 15.
Ben Stein Stuns Fox & Friends By Disagreeing With Party Line
In the past era, we hit a communications Boom. The onset of media has both enslaved and set the people free in different aspects.
TV and the internet has allowed people to communicate all over the world in the snap of a finger and compare ideals. This has educated the people on their subjugation and people have started to stand up and gain a voice for themselves. This IS NOT that the people have turned their back from any divine entity so much as they see the truth of Control and Enslavement both to religious ideologies and to political dominance. People are just now starting to free themselves from the chains and shackles of being force fed how they should see, hear, talk and think.
This is just the beginning, and I expect it to get worse, as people stand up all over the world and demand their own personal rights and opinions be observed, instead of dictated like Kings, Queens and Religion have been doing for centuries. Those that seek to dominate and rule over others will start to feel the backlash of the free spirit.
The key export for religion has always been control. The goal of the church has always been to enslave the weak minded and control them; tell them how to think, tell them how to act and direct them on every aspect of their lives.
So if you want to sell us that as a society, we have turned our backs from religion, then you better look at why. It hasn't been on a whim. It's because people are opening their eyes and standing up against the lies and the bull that they have been fed for countless years. Now that people can successfully communicate en mass, they are learning, and knowledge is power. People are standing up against authority because they are realizing that their authority was forced and not earned. Forced through, lies, deceit, cheating and all the other things that come with power.
As the people revolt, the power tries to hold on tighter by trying to limit what we have, whether it's free speech, freedom of movement, gathering in large numbers or communicating and sharing ideas (see the pattern here?)
The decention of society is due to the power struggle of the population finally looking up and identifying his prison guard.
Good or bad for society is yet to be seen but that's what's going on. People can accept some rules when the rules are equal but those rules no longer serve the people but are used to keep the people down then they are no longer rules but edicts!
>> ^shinyblurry:
>> ^RFlagg:
Problem is, they say the reason we were doing better was because we had God in schools, then we took him out of the schools and everything else... everything comes to how god was involved back then and less so now therefore we are paying the punishment of not having god in our lives... never mind how well many of the more atheist countries are doing (they think atheist countries are more like the old USSR)...
>> ^Fairbs:
Something most Republicans can't grasp is our country is better off when the rich are taxed more. 40 years ago, taxes on capital gains were 80%, but now Romney feels he's taxed too much at 15.
The argument isn't really about countries that are more atheist versus countries that aren't. It's that the United States has uniquely been a Christian nation since its founding. We are one nation, under God. Most people don't understand what that means; they think it is archaic when it is really the most important founding principle we have. The rapid decline in civil society has to do with the fact that, for the first time generations of Americans are growing up without the judeo-christian ethic being instilled in them from society, especially from their schools. And what we've seen since 1963 is a dramatic increase in the rate of violent crimes, teen pregnancy, STDs, the divorce rate, broken families, drug use, etc..the list goes on. There are the top 7 problems we had in our schools according to government records in 1940 vs 1990:
1940
1. Talking out of turn
2. Chewing Gum
3. Making noise
4. Running in the Halls
5. Cutting in Line
6. Dress-code violations
7. Littering
1990
1. Drug abuse
2. Alcohol abuse
3. Pregnancy
4. Suicide
5. Rape
6. Robbery
7. Assault
So, the argument is really that, we as a society have collectively turned our back on God, and therefore God has also turned His back on us. The principle is, you reap what you sow, and that's exactly what is going on right now. That's why this nation is facing calamity after calamity, because we have lost our way and we refuse to repent and turn back to our Creator.
Ben Stein Stuns Fox & Friends By Disagreeing With Party Line
>> ^RFlagg:
Problem is, they say the reason we were doing better was because we had God in schools, then we took him out of the schools and everything else... everything comes to how god was involved back then and less so now therefore we are paying the punishment of not having god in our lives... never mind how well many of the more atheist countries are doing (they think atheist countries are more like the old USSR)...
>> ^Fairbs:
Something most Republicans can't grasp is our country is better off when the rich are taxed more. 40 years ago, taxes on capital gains were 80%, but now Romney feels he's taxed too much at 15.
The argument isn't really about countries that are more atheist versus countries that aren't. It's that the United States has uniquely been a Christian nation since its founding. We are one nation, under God. Most people don't understand what that means; they think it is archaic when it is really the most important founding principle we have. The rapid decline in civil society has to do with the fact that, for the first time generations of Americans are growing up without the judeo-christian ethic being instilled in them from society, especially from their schools. And what we've seen since 1963 is a dramatic increase in the rate of violent crimes, teen pregnancy, STDs, the divorce rate, broken families, drug use, etc..the list goes on. There are the top 7 problems we had in our schools according to government records in 1940 vs 1990:
1940
1. Talking out of turn
2. Chewing Gum
3. Making noise
4. Running in the Halls
5. Cutting in Line
6. Dress-code violations
7. Littering
1990
1. Drug abuse
2. Alcohol abuse
3. Pregnancy
4. Suicide
5. Rape
6. Robbery
7. Assault
So, the argument is really that, we as a society have collectively turned our back on God, and therefore God has also turned His back on us. The principle is, you reap what you sow, and that's exactly what is going on right now. That's why this nation is facing calamity after calamity, because we have lost our way and we refuse to repent and turn back to our Creator.
Ben Stein Stuns Fox & Friends By Disagreeing With Party Line
Problem is, they say the reason we were doing better was because we had God in schools, then we took him out of the schools and everything else... everything comes to how god was involved back then and less so now therefore we are paying the punishment of not having god in our lives... never mind how well many of the more atheist countries are doing (they think atheist countries are more like the old USSR)...
>> ^Fairbs:
Something most Republicans can't grasp is our country is better off when the rich are taxed more. 40 years ago, taxes on capital gains were 80%, but now Romney feels he's taxed too much at 15.
Oculus Rift: The first truly immersive VR headset for games
Let me first say, I'm happy to see this. Any push on getting 3D gaming into the hands of more people is a good thing. However...
From their website: Resolution: 1280x800 (640x800 per eye)
Hmm, this is why I went with the Asus 1920x1080 Lightboost monitor over the Sony OLED head mounted display (added benefit: the monitor's a lot less dorky). While I hear the black levels on the OLED are incredible, it's a 720p display.. and I've read owners already regretting the "low rez" of the unit.
3D may not be everyone's bag for movies, but it's great for immersive gaming. Titles like Skyrim and Witcher 2 are freaking awesome in 3D.. but that low a rez is hard to go back to unless the unit's cheap(ish). At least with the monitor it serves well for gaming and everything else, and if a game doesn't work in 3D you get the 120hz, which is really nice for fluid gaming. These head units use 60hz per eye because there's no nead to flip between two images.. each eye gets it's own.
I'll be interested to hear how the huge FOV affects the experience though.
And for anyone getting into stereo gaming with an NVIDIA set up, this web site's invaluable. Someone figured out how to modify shaders in just about any game, and the community here modifies games to make them close to perfect in 3D, even some that were unplayable...
http://helixmod.wikispot.org/gamelist
edit-Alright, just read this in their FAQ
"While it’s true that the developer kit uses a relatively low-resolution screen (1280x800), we promise it delivers a compelling, immersive 3D experience. And to be clear, we plan on improving the resolution of the screen for the consumer version. Stay tuned for more details!"
Introducing Google Fiber: The Next Chapter of the Internet
The monthly download limit will be the same. You reach your cap in 0.8 seconds, and everything else is overage.