search results matching tag: natural selection

» channel: weather

go advanced with your query
Search took 0.001 seconds

    Videos (58)     Sift Talk (3)     Blogs (2)     Comments (434)   

The Incoherence of Atheism (Ravi Zacharias)

shinyblurry says...

@alcom

I hear you shinyblurry, but I feel that your argument meanders back to the original appeal to authority that most believers resort to when justifying their positions. I also find that the related video links provided by TheGenk provide a valid refutation of the idea that God is The One who put values of good and evil inside each of us.

There is always an appeal to authority, either to God or to men. There are either objective moral values which are imposed by God, or morality is relative and determined by men. If morality is relative then there is no good or evil, and what is considered good today may be evil tomorrow. If it isn't absolutely wrong to murder indiscriminately, for instance, then if enough people agreed that it was right, it would be. Yet, this does not cohere with reality because we all know that murdering indiscriminately is absolutely wrong. The true test of a worldview is its coherence to reality and atheism is incoherent with our experience, whereas Christian theism describes it perfectly.

If you feel the videos provide a valid refutation, could you articulate the argument that they are using so we can discuss them here?

In my mind, Zacharias' incoherence with the atheist's ability to love and live morally is influenced by his own understanding of the source of moral truth. Because he defines the origin of pure love as Jesus' sacrifice on behalf of mankind, it is unfathomable to him that love could be found as a result of human survival/selection based of traits of cooperation, peace and mutual benefits of our social structure. His logic is therefore coloured and his mind is closed to certain ideas and possibilities.

The idea of agape love is a Christian idea, and agape love is unconditional love. You do not get agape love out of natural selection because it is sacrificial and sacrificing your well being or your life has a very negative impact on your chance to survive and pass on your genes. However, Christ provided the perfect example of agape love by sacrificing His life not only for His friends and family, but for people who hate and despise Him. In the natural sense, since Jesus failed to pass on His genes His traits should be selected out of the gene pool. Christ demonstrated a higher love that transcends the worldly idea of love. Often when the world speaks of love, it is speaking of eros love, which is love based on physical attraction, or philial love, which is brotherly love. The world knows very little of agape love outside of Christ. Christ taught agape love as the universal duty of men towards God:

Luke 6:27 "But I say to you who hear, Love your enemies, do good to those who hate you,
Luke 6:28 bless those who curse you, pray for those who abuse you.
Luke 6:29 To one who strikes you on the cheek, offer the other also, and from one who takes away your cloak do not withhold your tunic either.
Luke 6:30 Give to everyone who begs from you, and from one who takes away your goods do not demand them back.
Luke 6:31 And as you wish that others would do to you, do so to them.
Luke 6:32 "If you love those who love you, what benefit is that to you? For even sinners love those who love them.
Luke 6:33 And if you do good to those who do good to you, what benefit is that to you? For even sinners do the same.
Luke 6:34 And if you lend to those from whom you expect to receive, what credit is that to you? Even sinners lend to sinners, to get back the same amount.
Luke 6:35 But love your enemies, and do good, and lend, expecting nothing in return, and your reward will be great, and you will be sons of the Most High, for he is kind to the ungrateful and the evil.
Luke 6:36 Be merciful, even as your Father is merciful.

Indeed, moral foundations can and must change with the times. As our understanding of empathy, personal freedoms and the greater good of mankind develops with our societal and cultural evolution, so too must our standards of morality. This is most evident when concepts such as slavery and revenge (an eye for an eye) are seen as commonplace and acceptable throughout old scripture where modern society has evolved a greater understanding of the need for equality and basic human rights and policing and corrections as a measure of deterrence and rehabilitation for those individuals that stray from the path of greatest utility.

This is why slavery is no more, why racism is in decline and why eventually gay rights and green thought will be universal and our struggle to stifle the rights of gays and exploit the planet's resources to the point of our own self-extinction simply will be seen by future historians as sheer ignorance. Leviticus still pops up when people try to brand gays as deviant, even though most it is itself incoherent by today's standards. Remember that "defecating within the camp was unacceptable lest God step in it while walking in the evening." Well, today we just call that sewage management.


Some people, like Richard Dawkins, see infanticide as being the greatest utility. Some believe that to save the planet around 70 percent of the population must be exterminated. Green thought is to value the health of the planet above individual lives; to basically say that human lives are expendable to preserve the collective. This is why abortion is not questionable to many who hold these ideals; because human life isn't that valuable to them. I see many who have green thoughts contrast human beings to cattle or cockroaches. Utility is an insufficient moral standard because it is in the eye of the beholder.

In regards to the Levitical laws, those were given to the Jews and not the world, and for that time and place. God made a covenant with the Jewish people which they agreed to follow. The covenant God made with the world through Christ is different than the Mosaic law, and it makes those older laws irrelevant. If you would like to understand why God would give laws regarding slavery, or homosexuality, I can elucidate further.

In regards to your paraphrasing of Deuteronomy 23:13-14, this is really a classic example of how the scripture can be made to look like it is saying one thing, when it is actually saying something completely different. Did you read this scripture? It does not say that:

Deuteronomy 23:13 And you shall have a trowel with your tools, and when you sit down outside, you shall dig a hole with it and turn back and cover up your excrement.

Deuteronomy 23:14 Because the LORD your God walks in the midst of your camp, to deliver you and to give up your enemies before you, therefore your camp must be holy, so that he may not see anything indecent among you and turn away from you.

Gods home on Earth was in the tabernacle, and because God dwelled with His people, He exorted them to keep the camp holy out of reverence for Him.

The rules that God gave for cleanliness were 2500 years ahead of their time:

"In the Bible greater stress was placed upon prevention of disease than was given to the treatment of bodily ailments, and in this no race of people, before or since, has left us such a wealth of LAWS RELATIVE TO HYGIENE AND SANITATION as the Hebrews. These important laws, coming down through the ages, are still used to a marked degree in every country in the world sufficiently enlightened to observe them. One has but to read the book of Leviticus carefully and thoughtfully to conclude that the admonitions of Moses contained therein are, in fact, the groundwork of most of today's sanitary laws. As one closes the book, he must, regardless of his spiritual leanings, feel that the wisdom therein expressed regarding the rules to protect health are superior to any which then existed in the world and that to this day they have been little improved upon" (Magic, Myth and Medicine, Atkinson, p. 20). Dr. D. T. Atkinson

What's interesting about that is that Moses was trained in the knowledge of the Egyptians, the most advanced civilization in the world at that time. Yet you will not find even a shred of it in the bible. Their understanding of medicine at that time led to them doing things like rubbing feces into wounds; ie, it was completely primitive in comparison to the commands that God gave to Moses about cleanliness. Moses didn't know about germs but God did.

Paedophilia will never emerge as acceptable because it violates our basic understanding of human rights and the acceptable age of sexual consent. I know this is a common warning about the "slippery slope of a Godless definition of morality," but it's really a red herring. Do you honestly think society would someday deem that it carries a benefit to society? I just can't see it happening.

en.wikipedia.org/wiki/Pederasty_in_Ancient_Greece

alcom said:

I hear you shinyblurry, but I feel that your argument meanders back to the original appeal to authority that most believers resort to when justifying their positions.

Riflebird Dance

This film should be seen by everyone

visionep says...

Looks like a thriving population. There probably isn't enough food so they eat stuff that they wouldn't naturally be interested in, like plastic and metal chips.

Evolution in process. The birds that learn not to eat the plastic will procreate and thrive. Natural selection is not pretty, but with a big population and enough generations these birds aren't likely to face extinction from the great garbage fields that currently exist out in the oceans.

Of course, you should still teach your kids to not to litter and to try and respect the environment. But picking out some birds dying because of man-made changes to their environment and not pointing out that nature itself kills huge populations of animals all of the time with poisons and invasive species is just over emphasizing a minor side affect of the growth of human civilization.

Cactus Bodyslamming: Acupuncture for Idiots

probie says...

Too stupid to live, and yet still able to breed. It might take a generation or two, but the Darwin Awards will catch up with his offspring (or him, if we're lucky).

Natural selection is fact, not theory.

Creationist Senator Can E. Coli Turn Into a Person?

BicycleRepairMan says...

It is absurd, but it is also evidently, and provably true. It is a fact. Back in the days of Darwin one could perhaps make the case that the idea of common descent was perhaps stretching it far, but the discovery and later sequencing of DNA makes it a slam dunk. There is no other even remotely reasonable conclusion you can make, but the one that says you are related to a tomato. and elephants, and chimps, and E.Coli and shrimps and everything else that has DNA. Not only do we all share the same basic system (why doesn't some species use different nucleic acids or something else to replicate?) But we share the SAME CODE. Even with our most distant cousins (something like E.Coli) have long strands of DNA code in common with us. The four nucleic acids of DNA , represented by the letters A,T,C and G are laid down by the thousands in patterns like: AAAATTCGGGTATTTATTTGCAAACCTTTT, and then we find the SAME CODE in completely "unrelated" species. But thats not all, the relatedness of the code is excactly what you would expect in the taxonomic tree, and infact it is now THE method for figuring out exactly how related one species is to another, and drawing the correct tree.

So all life IS related, which means it all has a common ancestor, which lived some 3 billion years ago. Which also means it had to be a simple form that diverged into all that we now have. And that process is evolution, and the main driving forceof evolution, by far, is natural selection. So we know that this process happens and that it can create amazing things from really much simpler things. All we need to postulate is the capability to self-replicate for those first replicators. Admittedly, this is pretty hard to envision, but we do know that all the basic building blocks (organic molecules) could arise spontaneously through non-replication. But we may never know exactly how it started, it would be something simple, like some organic molecules spontaneously forming RNA strands, which break in two and each half collects its counter-parts and form two RNA strands and so on...

bobknight33 said:

Evolution is real. However to imply or believe that all things evolved from the utter basic building blocks to what we have today is absurd.

Second Amendment Rights Gone Wrong

Ultimate Fails Compilation 2012

Bill Nye: Creationism Is Just Wrong!

shinyblurry says...

At present this concept of design is just castle-in-the-sky nonsense. Empty piffle. A complete non-starter.

This is why the "mere mention" of "design" will get you "banned" from peer-review, because you could just as well have made a "mere mention" of Bigfoot and the loch ness monster in your zoology report, it's a big tell to your peers that you are a nut who fails to understand the nature of evidence and science, and a big sign that you are in for some fuzzy logic and dumb assumptions instead of solid science.


Design is a better hypothesis for the information we find in DNA, and the fine tuning we see in the physical laws. The reason design is a non-starter is because the idea this Universe was created by anyone is anathema to the scientific community:

Even if all the data point to an intelligent designer, such an hypothesis is excluded from science because it is not naturalistic."

S. C. Todd,
Correspondence to Nature 410(6752):423, 30 Sept. 1999

It is not that the methods and institutions of science somehow compel us to accept a material explanation of the phenomenal world, but, on the contrary, we are forced by our a priori adherence to material causes to create an apparatus of investigation and set of concepts that produce material explanations, no matter how counterintuitive, no matter how mystifying to the unitiated. Moreover, that materialism is absolute, for we cannot allow a Divine foot in the door.

Richard Lewontin, Harvard
New York Review of Books 1/9/97

No evidence would be sufficient to create a change in mind; that it is not a commitment to evidence, but a commitment to naturalism. ...Because there are no alternatives, we would almost have to accept natural selection as the explanation of life on this planet even if there were no evidence for it.

Steven Pinker MIT
How the mind works p.182

After essentially nullifying and disproving everything we have learned about biology the last 200 years, you still have all the work ahead of you, I'm afraid. You now have to build a completely new framework and model for every single observation ever made in biology that makes sense of it all and explains why things are the way they are. Shouting that a thing is "complex" is not cutting it, I'm afraid. You need a new theory of DNA, Immunology, Bacterial resistance, adaptation, vestigal organs, animal distobution, mutation, selection, variation, genetics, speciation, taxonomy... well, as Dobzhansky put it: "Nothing in biology makes sense except in the light of evolution" That quote is more relevant than ever.

Your error here is conflating micro and macro evolution. Creation scientists believe in micro evolution and speciation. That is part of the creationist model of how the world was repopulated with animals after the flood. Macro evolution, the idea that all life descended from a universal common ancestor, is not proven by immunology, bacterial resistance, adaptation, animal distribution, mutation, seclection, variation, speciation, taxonomy etc. The only way you could prove it is in the fossil record and the evidence isn't there. They've tried to prove it with genetics but it contradicts the fossil record (the way they understand it). So Creationists have no trouble explaining those things..and common genetics points to a common designer.

You dont have to trust scientists, most of the EVIDENCE is RIGHT FUCKING THERE, in front of you, in your pocket, in your hand, around your home, in every school, in every home, in every post office or courtroom, in the streets. ACTUAL REAL EVIDENCE, right there, PROVING, every second, that the universe is billions of years old.

Every scientist since Newton could be a lying sack of shit, all working on the same conspiracy, and it would mean fuck all, because the evidence speaks for itself.

The earth is definately NOT ten thousand years young.


Have you ever heard of the horizon problem? The big bang model suffers from a light travel time problem of its own, but they solve it by postulating cosmic inflation, which is nothing more than a fudge factor to solve the problem. First, it would have to expand at trillions of times the speed of light, violating the law that says nothing can travel faster than the speed of light. There is also no theory compatible with physics that could explain the mechanism for how the Universe would start expanding, and then cease expanding a second later. It's poppycock. See what secular scientists have to say about the current state of the Big Bang Theory:

http://www.cosmologystatement.org/

As far as how light could reach us in a short amount of time, there are many theories. One theory is that the speed of light has not always been constant, and was faster at the beginning of creation. This is backed up by a number of measurements taken since the 1800s showing the speed of light decreasing. You can see the tables here:

http://www.answersingenesis.org/articles/cm/v4/n1/velocity-of-light

BicycleRepairMan said:

@shinyblurry

I have a concession, perhaps a confession to make. An admission if you will. I accept your thesis:

Natural Selection 2 (NS2) Launch Trailer

ant says...

>> ^dhdigital:

have to say its been a long time... I pre-purchased this years ago. Thanks for posting ant (and all the info bluesnews credits you for).
I guess I will finally load it up. last time I loaded it was 7/31/2010 (i was in the beta[/alpha?])


So, how is it now?

The Future of God: Harris&Shermer vs Deepak Chopra&J.Houston

KnivesOut says...

http://en.wikipedia.org/wiki/Patterns_in_nature

Natural selection and mutation over millions of generations in biological systems produces ordered results. On a cosmological scale, physical forces draw bodies into stable relationships. Science can easily explain how these phenomena occur.

But you don't really want answers.

"Tide goes in, tide goes out. You can't explain that.">> ^lantern53:

>> ^KnivesOut:
Certainly not by reading children's stories meant to scare simpletons into conformance. Observation, hypothesis, prediction, experiment, conclusion.>> ^lantern53:
Atheists believe order comes from chaos.
How do you defend that?


Many, if not most religious traditions use analogy to explain ultimate truths.
But explain to me how order comes from chaos?

Caterpillar commits suicide!

Bill Nye: Creationism Is Not Appropriate For Children

Stormsinger says...

I really don't understand why you bother. Shiny has proven time and time again that he's either incapable of understanding anything outside of his magic book, or he's nothing but a troll. I vote for the second, but the net effect is the same. You're wasting your time.>> ^ChaosEngine:

>> ^shinyblurry:
"Because there are no alternatives, we would almost have to accept natural selection as the explanation of life on this planet even if there were no evidence for it."
Steven Pinker,
Professor of Psychology, Massachusetts Institute of Technology, USA., "How the Mind Works," [1997]

You love this quote, don't you? I searched for it on google and fuck me if the first page or two isn't almost all you regurgitating this at every opportunity.
Now, here's the thing. You haven't read this book. Because if you had, you would have seen the next line.
"Because there are no alternatives, we would almost have to accept natural selection as the explanation of life on this planet even if there were no evidence for it. Thankfully, the evidence is overwhelming. I don't just mean evidence that life evolved (which is way beyond reasonable doubt, creationists notwithstanding), but that it evolved by natural selection."
But hey, let's ignore that bit. Let's live in shinys fantasy delusional that there isn't an almost overwhelming preponderance of data backing up evolution. Pinker would still be right. Why? Because there are no valid competing scientific theories. Literally. That's it. It's the only game in town. No-one has come even remotely close to explaining the diversity of life on this planet without evolution.
Intelligent design is not a theory. It fails almost every criteria.
So seriously, enough with the bullshit.

Bill Nye: Creationism Is Not Appropriate For Children

ChaosEngine says...

>> ^shinyblurry:

"Because there are no alternatives, we would almost have to accept natural selection as the explanation of life on this planet even if there were no evidence for it."
Steven Pinker,
Professor of Psychology, Massachusetts Institute of Technology, USA., "How the Mind Works," [1997]


You love this quote, don't you? I searched for it on google and fuck me if the first page or two isn't almost all you regurgitating this at every opportunity.

Now, here's the thing. You haven't read this book. Because if you had, you would have seen the next line.

"Because there are no alternatives, we would almost have to accept natural selection as the explanation of life on this planet even if there were no evidence for it. Thankfully, the evidence is overwhelming. I don't just mean evidence that life evolved (which is way beyond reasonable doubt, creationists notwithstanding), but that it evolved by natural selection."

But hey, let's ignore that bit. Let's live in shinys fantasy delusional that there isn't an almost overwhelming preponderance of data backing up evolution. Pinker would still be right. Why? Because there are no valid competing scientific theories. Literally. That's it. It's the only game in town. No-one has come even remotely close to explaining the diversity of life on this planet without evolution.

Intelligent design is not a theory. It fails almost every criteria.

So seriously, enough with the bullshit.

Bill Nye: Creationism Is Not Appropriate For Children

shinyblurry says...

@ChaosEngine

Oh sweet irony, I'm being called wilfully ignorant by a young-earther.

I'm not going to refute you. I don't need to; @BicycleRepairMan has already done an excellent job of it.


An excellent refutation? He cherry picked one sentence out of my reply, a reply where I had demonstrated the fallacy of his argument from incredulity by proving his assumption of the constancy of radioactive decay rates was nothing more than the conventional wisdom of our times. Is this what passes for logical argumentation in your mind? He posited a fallacious argument. I exposed the fallacy. He ignored the refutation and cherry picked his reply. You seem to be showing that in your eagerness to agree with everything which is contrary to my position that you have a weak filter on information which supports your preconceived ideas. Why is it that a skeptic is always pathologically skeptical of everything except his own positions, I wonder?

@BicycleRepairMan

...and to see an exampe of such a racket, check the flood "geology" link.

Seriously, you cant see the blinding irony in your own words? So, things like radiometric dating, fossils, geology, astronomy, chemistry, biology are all just parts of a self-perpetuating racket confirming each others conclusions in a big old circlejerking conspiracy of astronomical proportions.. well, lets assume then that it is. So they are basically chasing the foregone conclusion that the universe is over 13 billion years old and that life on this planet emerged some 3,6 billion years ago and has evolved ever since. But where did these wild conclusions come from? Who established the dogma that scientists seems to mindlessly work to confirm, and why? And why 13,72 billion years then? Why not 100 billion years, or 345 million years?

The thing is, what you have here is an alleged "crime" with no incentives, no motivation.. Why on earth would all the worlds scientists, depentently and independently and over many generations converge to promote a falsehood of no significance to anyone? it might make some kind of sense if someones doctrine was threatened unless the world was exactly 13.72 billion years old. Or if someone believed they were going to hell unless they believed trilobites died out 250 million years ago.. The thing is, nobody believes that.

The truth is pretty much staring you in the face right here. The conclusions of science on things like the age of the earth emerged gradually; Darwin, and even earlier naturalists had no idea of the exact age of the earth, or even a good approximation, but they did figure this much: It must be very, very old. So old that it challenged their prior beliefs and assumptions about a god-created world as described in their holy book. And thats were nearly all scientists come from: They grew up and lived in societies that looked to holy books , scripture and religion for the answers, and everybody assumed they had proper answers until the science was done.If scientists were corrupt conspirators working to preserve dogma, they be like Kent Hovind or Ken Ham. Ignoring vast mountains of facts and evidence, and focus on a few distorted out-of-context quotations to confirm what they already "know".

Not only was your prior argument fallacious, but I refuted it. Now you're ignoring that and cherry picking your replies here. Seems pretty intellectually dishonest to me? In any case, I'll reply to what you've said here. I was going to get into the technical issues concerning why scientists believe the Universe is so old, and the history of the theory, but so far you have given me no reason to believe that any of it will be carefully considered.

Instead I'll answer with a portion of an article I found, which was printed in "The Ledger" on Feb 17th 2000. It's interview of a molecular biologist who wanted to remain anonymous

Caylor: "Do you believe that the information evolved?"

MB: "George, nobody I know in my profession believes it evolved. It was engineered by genius beyond genius, and such information could not have been written any other way. The paper and ink did not write the book! Knowing what we know, it is ridiculous to think otherwise."

Caylor: "Have you ever stated that in a public lecture, or in any public writings?"

MB: "No, I just say it evolved. To be a molecular biologist requires one to hold onto two insanities at all times:
One, it would be insane to believe in evolution when you can see the truth for yourself.
Two, it would be insane to say you don't believe evolution. All government work, research grants, papers, big college lectures -- everything would stop. I'd be out of a job, or relegated to the outer fringes where I couldn't earn a decent living.”

Caylor: “I hate to say it, but that sounds intellectually dishonest.”

MB: “The work I do in genetic research is honorable. We will find the cures to many of mankind's worst diseases. But in the meantime, we have to live with the elephant in the living room.”

Caylor: “What elephant?”

MB: “Creation design. It's like an elephant in the living room. It moves around, takes up space, loudly trumpets, bumps into us, knocks things over, eats a ton of hay, and smells like an elephant. And yet we have to swear it isn't there!”

Here are some selected quotes:

We take the side of science in spite of the patent absurdity of some of its constructs, in spite of its failure to fulfill many of its extravagant promises of health and life, in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism. It is not that the methods and institutions of science somehow compel us to accept a material explanation of the phenomenal world, but, on the contrary, that we are forced by our a priori adherence to material causes to create an apparatus of investigation and a set of concepts that produce material explanations, no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is absolute, for we cannot allow a Divine Foot in the door.

Richard Lewontin

"In China its O.K. to criticize Darwin but not the government, while in the United States its O.K. to criticize the government, but not Darwin."

Dr. J.Y. Chen,

Chinese Paleontologist

Even if all the data point to an intelligent designer, such an hypothesis is excluded from science because it is not naturalistic."

S. C. Todd,
Correspondence to Nature 410(6752):423, 30 Sept. 1999

"Because there are no alternatives, we would almost have to accept natural selection as the explanation of life on this planet even if there were no evidence for it."

Steven Pinker,
Professor of Psychology, Massachusetts Institute of Technology, USA., "How the Mind Works," [1997]

"Biologists are simply naive when they talk about experiments designed to test the theory of evolution. It is not testable. They may happen to stumble across facts which would seem to conflict with its predictions. These facts will invariably be ignored and their discoverers will undoubtedly be deprived of continuing research grants."

Professor Whitten,
Professor of Genetics, University of Melbourne, Australia, 1980 Assembly Week address.

"Science is not so much concerned with truth as it is with consensus. What counts as truth is what scientists can agree to count as truth at any particular moment in time. [Scientists] are not really receptive or not really open-minded to any sorts of criticisms or any sorts of claims that actually are attacking some of the established parts of the research (traditional) paradigm, in this case neo-Darwinism. So it is very difficult for people who are pushing claims that contradict that paradigm to get a hearing. They find it hard to [get] research grants; they find it hard to get their research published; they find it very hard."

Prof. Evelleen Richards,
Historian of Science at the University of NSW, Australia

Speaks for itself, I think..

Natural Selection 2 (NS2) | Exosuit Reveal Trailer



Send this Article to a Friend



Separate multiple emails with a comma (,); limit 5 recipients






Your email has been sent successfully!

Manage this Video in Your Playlists