search results matching tag: descent
» channel: weather
go advanced with your query
Search took 0.000 seconds
Videos (139) | Sift Talk (2) | Blogs (11) | Comments (337) |
Videos (139) | Sift Talk (2) | Blogs (11) | Comments (337) |
Not yet a member? No problem!
Sign-up just takes a second.
Forgot your password?
Recover it now.
Already signed up?
Log in now.
Forgot your password?
Recover it now.
Not yet a member? No problem!
Sign-up just takes a second.
Remember your password?
Log in now.
How you doing, Richard? You alright?
I see Noel's still continuing his slow descent into vampirism.
Native American Shuts Down Anti-Illegal Immigrant Protest
Last time I brought up this issue to an anti-immigrant group, all I heard was crickets. Then I asked them how many of them were Native American descent . . . none? Oh, sorry, I guess being the only one with actual Native American ancestry I'm the only one who can complain. Europeans stole this land, and now they're upset it's being stolen from them. Oh, the irony. Only, irony doesn't apply when you're too stupid to read basic history.
Creationist Senator Can E. Coli Turn Into a Person?
It is absurd, but it is also evidently, and provably true. It is a fact. Back in the days of Darwin one could perhaps make the case that the idea of common descent was perhaps stretching it far, but the discovery and later sequencing of DNA makes it a slam dunk. There is no other even remotely reasonable conclusion you can make, but the one that says you are related to a tomato. and elephants, and chimps, and E.Coli and shrimps and everything else that has DNA. Not only do we all share the same basic system (why doesn't some species use different nucleic acids or something else to replicate?) But we share the SAME CODE. Even with our most distant cousins (something like E.Coli) have long strands of DNA code in common with us. The four nucleic acids of DNA , represented by the letters A,T,C and G are laid down by the thousands in patterns like: AAAATTCGGGTATTTATTTGCAAACCTTTT, and then we find the SAME CODE in completely "unrelated" species. But thats not all, the relatedness of the code is excactly what you would expect in the taxonomic tree, and infact it is now THE method for figuring out exactly how related one species is to another, and drawing the correct tree.
So all life IS related, which means it all has a common ancestor, which lived some 3 billion years ago. Which also means it had to be a simple form that diverged into all that we now have. And that process is evolution, and the main driving forceof evolution, by far, is natural selection. So we know that this process happens and that it can create amazing things from really much simpler things. All we need to postulate is the capability to self-replicate for those first replicators. Admittedly, this is pretty hard to envision, but we do know that all the basic building blocks (organic molecules) could arise spontaneously through non-replication. But we may never know exactly how it started, it would be something simple, like some organic molecules spontaneously forming RNA strands, which break in two and each half collects its counter-parts and form two RNA strands and so on...
Evolution is real. However to imply or believe that all things evolved from the utter basic building blocks to what we have today is absurd.
Crazy Landing!! Kids, do not repeat this at home!!
I'm a pilot, I know the rules and regulations. I thought I'd put that in my last reply, but it looks like I didn't. The PC-6 is designed to do this maneuver, and if it were dangerous it wouldn't be certified to do it.
The posted video and the one I linked to are doing the same thing, a rapid descent (also called emergency descent). Generally rapid descents call for slowing down to the safest operating speed with which the aircraft can fly with flaps and landing gear extended (it's usually marked on the airspeed indicator), bank into a 45° or greater turn and use pitch to keep the speed right at the max allowed speed. This is the fastest way to lose altitude without gaining excessive airspeed. Instead of using steep turns, the PC-6 uses its prop as a brake and can just descend at a steep angle without having to watch airspeed to avoid damaging flaps or gear by accidentally going too fast.
I don't want to drag this conversation out any longer, so I will just sum it up with this blanket statement. Decent, approach and landing make up about half of the risk area in flying statistically speaking. Private Part 91/General Aviation constitute the highest level of risk of any aviation. Human factors are by far the most common accident type, and this type of hurried flying is just a "human factor" accident waiting to happen. With that said, I bet there is a very small accident rate on things like this overall, but if there is, it is on someones head. So while I was being kind of hyperbolic because of my fear of flying, there are still risks to consider, and this type of hurried landing style is a style that is a human factor crash waiting to happen, which is the highest factor in crashes, during the highest risk part of a flight, in an aviation mode with the highest level of deaths per miles. He is, by statistical analysis, engaging in the most risky set of flight behaviors and conditions possible. And I am fine with that, as long as he isn't doing it over my house. That is all from me good sir, over and out!
http://www.planecrashinfo.com/cause.htm
Crazy Landing!! Kids, do not repeat this at home!!
What's "not cool" about it? The plane is designed to fly in and out of remote airports with short unpaved runways. It's basically using the propeller as an air brake which allows for a near vertical descent without building up excessive airspeed. Sky diving operators use it because it can make it back to the airport before the sky divers hit the ground and be ready to go up again. Other planes would take several minutes to safely descend from high altitudes, using more fuel and time.
Wow, someone take his licence away! Doing that above houses and stuff is not cool.
Descent to UDK - Experimental
>> ^Stormsinger:
Refresh my memory...wasn't Descent completely lacking in anything to help you visualize the map of the area? Because if it's the game I'm thinking it was, that was what killed it for me. I ended up lost within the first 5 minutes every time.
Yeah, Descent had no way to orient yourself to the map, so it was like playing 4 maps at once. And in modem play you could easily spend a good amount of your time just looking for your opponent.
So it looks like this version is being built in one of the Unreal engines because that map is definitely Deck 16 or some later derivative.
Fun times.
Descent to UDK - Experimental
Refresh my memory...wasn't Descent completely lacking in anything to help you visualize the map of the area? Because if it's the game I'm thinking it was, that was what killed it for me. I ended up lost within the first 5 minutes every time.
Descent to UDK - Experimental
>> ^TheFreak:
Oh man, I played the CRAP out of descent.
Isn't that Deck 16?
No idea, but it looks rad(ical). I remember playing its time limited multiplayer demo. through Kali!
Descent to UDK - Experimental
Oh man, I played the CRAP out of descent.
Isn't that Deck 16?
Fletch (Member Profile)
Congratulations! Your comment has just received enough votes from the community to earn you 1 Power Point. Thank you for your quality contribution to VideoSift.
Mars Curiosity Descent - WOW This is Beautiful!
>> ^Gutspiller:
That last picture is faked where it shows the rover and a sound zooming out. That's zooming out of a still image, as there is no motion of all that sand moving between the camera and the rover.
Artistic license.
Mars Curiosity Descent - WOW This is Beautiful!
>> ^Fletch:
If you look closely near the bottom the screen (about an inch above the lower edge of the video on my monitor) at the 1:20 mark, just left of center, you can see the heat shield hit and the subsequent plume of dirt that it creates. Watch it in 1080p (full screen) for the clearest view.
Thanks! I knew this was in the video somewhere, but since the frame pans off the heat shield's descent for several seconds I kept losing it.
Mars Curiosity Descent - WOW This is Beautiful!
>> ^siftbot:
Adding video to channels (<a rel="nofollow" href="http://engineering.videosift.com" style="color:#FF9933">Engineering, <a rel="nofollow" href="http://science.videosift.com" style="color:#088A4B">Science, <a rel="nofollow" href="http://win.videosift.com" style="color:#99D700">Win, <a rel="nofollow" href="http://wings.videosift.com" style="color:#1E90FF">Wings) - requested by Trancecoach.
Hold on. Does every time we invoke a "wings" channel mean that siftbot automatically think that we're also requesting "win"?
Not to say that this video doesn't deserve the "win" channel. I'm just pointing out a potential problem in the way siftbot reads the "wings" invoke.
Mars Curiosity Descent - WOW This is Beautiful!
>> ^ReverendTed:
>> ^ant:
timeshift
?
Timelapsed with various shots.
Mars Curiosity Descent - WOW This is Beautiful!
>> ^ant:
timeshift
?