search results matching tag: To Arise
» channel: weather
go advanced with your query
Search took 0.000 seconds
Videos (58) | Sift Talk (10) | Blogs (2) | Comments (453) |
Videos (58) | Sift Talk (10) | Blogs (2) | Comments (453) |
Not yet a member? No problem!
Sign-up just takes a second.
Forgot your password?
Recover it now.
Already signed up?
Log in now.
Forgot your password?
Recover it now.
Not yet a member? No problem!
Sign-up just takes a second.
Remember your password?
Log in now.
Trancecoach
(Member Profile)
read your response.
a lot of postulating and assumptions.
i know (or assume) not with ill-intent,but still there.
gonne have to go bullet form here..blech..loathe bullet form.
please forgive.
1.i did not suggest "full-blown" socialism.nor did i suggest we do what has been tried in the past.
silly,un-imaginative tripe fed by over-paid and dull thinking professors.
ever wonder why there is an economics course and a business admin course?
there is a reason for that.one is theory the other practical application.
and economists get it wrong...and often.
2.you mentioned twice socialism in relation to fascism.
are you aware they are not even on the same playing card?
meh..i guess we could call the corporate socialism we have now a form of fascism...but it would be a stretch.
do not confuse a political system with an economic one.
3.you think everything should be subject to a free market.even firefighters,police and roads.
i do not think you thought that particular nugget through.
the problems with socialism are well documented and well understood.
as are the problems with capitalism.
the real problems arise when things are not taught properly.
problems arise when people are taught that democracy and capitalism are somehow like peas and carrots.meant for each other.
that they are the end all be all and make jesus smile.
corporate propaganda bullshit.
france is a democracy.
they have capitalism AND socialism.
in fact..when you look how how many of the european socialist countries are doing and compare them to..well..us.they seem to be doing quite well for themselves.
so i dont know where you get your "socialism is a failure" idea from.
i guess i owe you an apology.you thought i was attacking you in some manner.not at all.
i was stating your right to disagree with me.
i was not conflating that somehow socialized medicine is somehow better or produces better health and that somehow a free market person wants death to all kittens.
my point is that health care should be a collective project but i believe i also entertained a free market solution as well.
BUT..the playing field has to..MUST..be level for all players.
it appears that some of my comments you took as directed towards you my friend.
this is not the case.
unless you ARE healthcare and in that case i am in the matrix.
the quote i posted is from adam smith.from his stellar book 'wealth of nations".
too bad his words have been twisted and contorted to not even have the same meaning anymore.oftentimes it is professors who perpetrate this travesty.
what adam smith was trying to convey is that for a free market to truly work as balancing agent and force corrector there had to be absolute liberty.
but we dont have that do we?
therefore it stands to reason we cannot have a free market.
ok ok.
i do not "feel" we live in a plutocracy.
i know it.
a legislation that has been purchased by wall street and corporate elite to enact laws which benefit them and their companies in the form of capital gain is..by definition..plutocracy.
smart ass
look man.
i think we are coming from the same place but have come to different conclusions.
you know..opinions.
you mentioned cuba as an example of poor socialized medicine.
well allow me to point out bangledesh slums,or somlia and their roving band of warlords.
they have free markets.
the discussion you and i are having is really 'what is governments role".
i agree with so many of your points..truly.
in my opinion the governments role in regards to commerce should be that a fraud police.thats it.
AND to dissolve the corporation and go back to the 1864 model.
if we cant do that at least..the very least...rewrite the corporate charter.
if we cant do that can we at LEAST put back the line "for the public good" (removed in 1967 or 68).
and make these huge entities accountable for their actions and made liable for any and all :death,destruction,disease and suffering.
could we..could we ..please pa..could we?
weeeeell,thats never gonna happen.the reason the west developed was due to governments and corporations getting in bed with each other.
no way america would have the standard of living we have without that ugly beast.
people think america goes to war for ideology?
ha! not a chance.
its fucking business baby!
so..yeah.
my friend there are no easy answers.
and i apologize if you took my previous comment as an attack on you in any way.
never..ever ever.
i respect and admire you immensely.
though i disagree with you on this,that will never take away on how i perceive you.
i am a dissident.
an anarchist.
i have unplugged from the system many moons ago.i refuse to feed the beast.
i did my duty and gave this country a few years and then turned my back and walked away.
which i know may seem in contradiction to what i am proposing in regards to healthcare.
maybe i am naive in some respects,but government does have a role and i would prefer it to be at the betterment of its citizens.
social security has been a great success (not according to some people but look at the stats..it has been fantastic).
you are so right that this is not an issue handled and packaged in one easy sitting.it takes discussion of hard truths.
but for that to happen there has to be respect and i respect you immensely my friend.
it is getting late and i am one pooped lil puppy.
but i am fully enjoying my conversation with you.
let me end with sharing a man who makes an argument so much better than i could.
he is an economist.so he is probably wrong.
enoch
(Member Profile)
Hey @enoch,
> dude,
> i totally appreciate the time you took to respond.
Sure, not a problem. It's a complex issue, and requires the time to consider and understand the details.
> "for a free market to exist there also has to be absolute liberty.-
> adam smith we have neither.
> IF we did,i would not be against a free market system.
> at least not in totality."
Uh-oh, I hope this isn't a "lesser of two evils" argument.. That is, "since we cannot have a free market lets go for full-blown socialism because it is supposedly better than fascism." It's a false choice and not one I think any true humanitarian would be willing to entertain.
> "should EVERYTHING be subject to a free market? police?
> firefighters? roads?"
In short, yes. Aversion to socialism is based on reality, in contrast to what you're saying. Socialism is failure. Central planning inevitably fails. Central planners do not have the required knowledge to plan an economy. You need economic calculation and economic calculation is impossible to achieve in a socialist "economy."
> "to me health should be a basic part of civilized society,by your
> arguments you disagree. ok..we both have that right."
Are you trying to conflate "socialized healthcare" with health? Let's not confuse the facts with personal attacks. You seem to be saying, "if you are against socialism you are against health." That makes no sense. None.
I might as well say, "If you are against free markets you are against health."
> "my argument is that some things should be a basic for civilized
> society. in my opinion health care is one of them."
In no way did I ever say that I am against healthcare. So what are you talking about?
> "for a free market to exist there also has to be absolute liberty.-
> adam smith we have neither."
You cannot have a free market without liberty any more than you can have liberty without liberty. This is obvious, so?
> "IF we did,i would not be against a free market system.
> at least not in totality."
So, if we had a free market, you wouldn't be "against" a free market? Hmm.
> "the reason why i dont feel a free market is the way to go is
> mainly due to the fact that politics and corporations have merged
> into one giant behemoth (plutocracy)."
That's fine, but this is not a matter of "feeling" but a matter of economic reality and empirical evidence and deductive truth.
> "i never really understood americans aversion to "socialism""
Perhaps some economic education will clarify things. Understanding economic calculation, for example, might be a good place to start.
> "i deal with the very people that could NEVER afford you."
You're wrong. For one thing, while I do work at a significant fee for my primary clients, I do a significant amount of pro bono work, as a choice, and because I, like you, believe that health care is a human right. And that's a key point you need to understand. You seem to believe that, if the state doesn't take care of people, then no one will, and so we need to steal money from people in the form of taxes, under the auspices of "helping the poor," when in fact, the bureaucrats ensure that only a portion (if any) of those taxes actually arrive with their intended recipients while those who would willingly help those people themselves are deprived of the resources to do so, by depleting their income with said taxes. It's an unnecessary middleman, and faulty logic. The fact that people have, do, and will continue to care about people is the fundamental fact the needs to be understood. As a "man of faith," I would hope that you have enough faith in other people that they would care about and for others (even without being coerced by the government to do so, by force).
Furthermore, we have to apply the free market in toto, not half-assed. You can't have a Keynesian corporatists and an over-regulated system and expect that people will be be able to afford healthcare. The fact is that in a free market, the number of people who cannot afford my services would actually decrease considerably, because many more options would arise for those who still couldn't afford me would but need my services.
> "in a free market there will be losers.the one who always lose.
> the poor,the homeless,the mentally ill."
The free market has ways of dealing with all of these. And yes some win, some lose. But in a socialist system, everyone loses (except for maybe the rulers and their lackeys). This seems, again, to be coming from a place of fear, a sense of helplessness without the government. But alas, nothing contributes to poverty, homelessness, and mental illness more than government does. Fact.
> "the free market is still profit driven and the poor will have it no
> better,possibly worse in such a system."
So, what is your proof that the poor will have it worse? How do you know? Or is this what you "feel" would be the case?
> "the reason why i suggested medicare is because it is already in
> place."
So was slavery when the South decided they wanted to keep it.
> "two things would happen if this country went the medicare route:
> 1.health insurance industry would obsolete.
> 2.the pharmaceutical industry would find itself having to negotiate
> drug prices"
1. Yes, the government would have a monopoly on health coverage, and by extension all of healthcare. Economic calculation at this point becomes utterly impossible. Chaos follows. And healthcare quality and service plummets. I have research studies to support this if you're interested.
2. Why not nationalize pharmaceuticals while you are at it?
> "i may be a man of faith but i am a humanist at heart.for-profit
> health care will still have similar results as our current because
> the poor and working poor population is growing."
Without appealing to moral superiority, allow me to assure you that there is nothing -- not one thing -- that is moral or ethical about allowing the government coerce, aggress, commit violence, and violate individual's inalienable rights to self-ownership and property rights, as you proposing with such socialist "solutions." In my humble opinion, a true man of faith would not stand for such things, but would stand against them.
> "the poor and working poor population is growing."
Indeed we do, and we all have inflation, cronyism, Lord Keynes' bogus economic "system" and government's meddling to thank for this.
> "i am all for an actual free market but some things should be done
> collectively."
By "collectively," I assume you mean "by central authorities," yes? Because the free market is, in fact, collective. But there is nothing "collective" about central planning. Except for the fact that the "collective" is mandated to obey the dictates of the central planners.
> "its not only the right thing to so but the human thing to do."
1. Whatever your "feelings" are about it, there is an economic reality to deal with. Such a sentiment misses the point, and will result in hurting more people than it helps.
2. There is nothing "human" (or humane) in aggression, coercion, and violations of sovereignty, all of which underpins an implementation of a socialized system.
"The right thing to do" is to respect self-ownership and property rights. Doing anything else will eventually backfire. "People are not chessmen you move on a board at your whim."
Any one who is serious about contributing to solving and/or ameliorating the issues of poverty, homelessness, and/or mental illness and many of the other symptoms of our social detritus, needs to develop real, sustainable free market solutions to these. Otherwise, their efforts will be in vain (even if -- or perhaps especially if -- they are adopted by government for implementation). Anything else will not improve any of these but will only serve to make matters worse.
Going back to the basics, free market competition will always provide better goods/services at lower prices than the monopolies (fostered and engendered by the lack of economic calculations due to governmental intervention and regulations). Healthcare is no exception to this. Why would it be? Furthermore, why believe that the central planners/kleptocrats aren't profit-driven? Why believe that a "government" monopoly doesn't suffer from a lack of economic calculation? And what's wrong with being profit-driven, however you may individually define "profit?" Do you/I/we not act for what you/I/we consider the best? (Having faith is not a part-time job.)
Do you not act to achieve desired goals?
I'll give you the benefit of the doubt and say that you haven't fully thought things through. But as I'm sure you know, "It is easy to be conspicuously 'compassionate' if others are being forced to pay the cost."
> "thats my 2 cents anyways.i could probably ramble on for a few
> hours but i dont want to bore you. always a pleasure my friend.
> namaste"
It's not boring, but does take a bit of time to consider and understand all of the details. It's complex, and certainly a challenge to navigate your way through the morass of rhetoric, conditioning, and cultural misdirection that is pervasive in our society, especially when considering what passes for "news" and "facts." This is particularly true with regards to the economy, which is heavily politicized, despite being a rational science that can be understood if one takes the time to learn about its mechanism.
Since you signed off with "namaste," perhaps it would be worth reminding you that the first principle of yoga is "ahimsa para dharma" : non-violence is the highest duty.
Perhaps videosift isn't the best medium in which to educate people on non-violence and economics, but alas, it can be entertaining and, possibly have have some positive effect at some point.
Hope this helps.
<snipped>
Quantum Computing Explained
I still dont understand how you can calculate something using qbits, have them compute a problem (without you observing them doing it), and observe the result...AND have faith that the result when you observe it is accurate..
How would you know when to observe it?
How can a calculative function arise from quantum, unobserved, randomness?
It seems batshit crazy to me.
DEFCON 20 Documentary
*PROMOTE the clearing of beggars from the front stoop...feed them please, if necessity arises in the hall near the back door servant's entry-MGMT
"Don't F**k with New York" - Lewis Black Slams Texas
Uhhh,the states' big and beautiful-Best roads anywhere and self-sufficient as her own country should the necessity arise-Plenty of thicket, lotsa places to hide....Multicultural, hip, with a few fuckers who give it a bad name, not unlike (insert your shit state here) most places......except for Rhode Island.
Rick Perrys' a solid piece of shit, cured in a brick oven.
Austins' getting polluted with posers and hipsters and it grew to fast, it used to be cool about 30 years ago....clusterfuck of traffic and pretentious hipsters now.
Austin's alright.
Pump-Action Shotgun Fail.
Responsibility is a good teacher, but only when it's enforced. Rules and laws are responsibilities, you still have the ability to make your own decisions as to whether to be responsible. Society has the responsibility to punish you for being irresponsible. That simple.
You have the "freedom" to break any law/rule you want, you'll only "learn" it's wrong to do so if you have to be responsible for your actions. Removing responsibility removes incentive for learning.
The solutions people have come up with to solve the ever changing issues that arise from "freedom" are called "laws"...and you want to remove them? Um....
The original point here was that removing the gun show loophole does not remove freedom or add rules, except the freedom to escape responsibility for improperly using a gun thanks to it not being registered to you.
edit: or the freedom to easily possess an unregistered firearm when you are legally prohibited from owning any firearm.
I don't see an issue with asking citizens to demonstrate in some way their level of responsibility when operating any dangerous item (at least items that can be dangerous to others when operated improperly). We do it for cars, we do it for knifes (if you intend to use it on a person, you must be a DR.), we do it for planes and boats. Sadly just getting a person to admit they purchased a firearm and proving they aren't legally insane is too much responsibility for some. You have said that somehow that instills responsibility with out ever explaining why or how.
I didn't think I was rude in the least, I explained humorously that you completely missed the point and asked you to try again. When you did, you agreed with me, mostly.
@newtboy my bad, no need to be rude. You could take into consideration that, with time, conditions change. An environment where people enjoy freedom also gives them more incentive to come up with solutions to problems that arise.
You say freedom is not a good teacher, ok, it's not entirely unreasonable to assume you're right. So, what would be a better teacher, then? Making decisions for people while they learn to mature and become more responsible, then give them freedom afterwards. You know, like we do with children?
It's not a bad idea, but it's kind of condescending considering that we're talking about adults here.
Pump-Action Shotgun Fail.
@newtboy my bad, no need to be rude.
You could take into consideration that, with time, conditions change. An environment where people enjoy freedom also gives them more incentive to come up with solutions to problems that arise.
![](https://videosift.com/vs5/emoticon/oops.gif)
You say freedom is not a good teacher, ok, it's not entirely unreasonable to assume you're right. So, what would be a better teacher, then? Making decisions for people while they learn to mature and become more responsible, then give them freedom afterwards. You know, like we do with children?
It's not a bad idea, but it's kind of condescending considering that we're talking about adults here.
NSA (PRISM) Whistleblower Edward Snowden w/ Glenn Greenwald
Reading the comments, my fear is that the outrage people are feeling is being framed in the wrong context. If we don't get the proper handle on this, all that outrage is going to fall on deaf ears. The people who are at the root of this are going to sense that we don't understand what's going on and dismiss all protests as irrelevant.
This is certainly not an issue of "evil government" or "power hungry institutions". This is an issue that involves people. People that are just like you and me. In fact, the ones who are responsible for the monster that's been created ARE people with the same motivations and rational capacity as you and I.
"We have met the enemy, and he is us." - Pogo
We are almost all guilty of making personal, selfish, idealistic and altruistic choices with blinders on to the larger impact of our choices. We all have a frustrating capacity for focusing on small picture goals and ignoring the big picture results. How many of us work for industries that have horrible environmental and social impact? Do you ever take into account the contribution you make to those disasters? Or are you comfortable in the belief that one person, "you", making fried chicken isn't responsible for the agregious level of child obesity in your country? Or you satisfied that building servers for BP doesn't in any way make you culpable for the massive negative impact of the industry as a whole?
We want to frame the ills of our societies in terms of villains which we can name...and even put a face on. But in the large chain of decisions that must be made and actions that must be taken, there is almost never one individual with the power to change the course of events. If one is ever identified, that person is almost certainly a scape goat, selected by popular consent for the very purpose of putting a face to the atrocities.
Governments and corporations are collections of individuals with the same strengths, weaknesses and short sightedness that we all posses.
So this problem arises from a troubling mentality that's very common in all orginzations. The tendency to view our individual actions and contributions as discrete from the larger result of the group. A small minded focus on results over impact.
This issue needs to be addressed in those terms, the troubling realization that good people with good intentions lost sight of the bigger picture. Only then will our protests ring true to the people involved.
And understand what's being discussed here also. This is not about personal invasion of privacy. That's certainly not how the architects of this see it. This is not the local police wire tapping "you". This is about a massive collection of data that could never be utilized effectively in those terms. It's complete historical data that exists for the purpose of analyzing as a whole, to learn the patterns that signify the actions of people who would do you harm. It is at the point such patterns are identified that investigation at an individual level, within that data, would begin. Perhaps that's why the people who created and manage this system don't feel it's a threat to you. Because they have no interest in you and didn't design the system for you...assuming you're not a terrorist.
But the danger that WE know is real, that they've lost sight of, is a matter of degrees. What happens when the definition of "enemy" begins to slip? What happens when, over time, all dissent is viewed as disruptive to the security of the country?
That's the big picture and that's the danger. Make sure you're protesting the right thing, if you want to be heard.
Obama is NOT the 'Change' We Believed In
Worst he's failed to accomplished is the gun bullshit-We wouldn't have even known about the "create the problem provide a solution" fast-and-furious crap if an agent hadn't been killed-The combination of rhetoric arising from Gifford and Sandyhook fueled the furnace, these are cocky bastards running a game down on the country because they know they can at this stage in the game. Give guns to feral Mexicans. Brilliant you dumb motherfuckers, brilliant. Fuck You. Oh, and now you want my taxes...Fuck you AND a bank.
inside monsanto-scientists talk about the truth
☝☝☝
Rational eh?
Criminals polluting the world's food production and distribution with a cadre of lawmakers and lawyers poised to give the beast a free-pass for the foreseeable future?
In March of this year, complicit cunt Obama signed H.R. 933, ‘Consolidated and Further Continuing Appropriations Act, 2013’-Missouri Senator Joe Blunt (R) worked with Monsanto to craft the language of a 78-page section of the bill which effectively protects biotech companies from judicial scrutiny should any notable public health risks arise as the result of GMOs. -IB Times’ Connor Sheets adds, “choosing to sign a bill that effectively bars federal courts from being able to halt the sale or planting of GMO or GE crops and seeds, no matter what health consequences from the consumption of these products may come to light in the future.”
Their army of lawyers-as formidable as any of Walmart's punk-ass legal teams, work constantly to keep information out of the public scrutiny while cementing the future experimentation on humans with their tweaks to the staple food sources of the planet's food. Over-reacting??
How does one "rationally oppose" the calculated acts of criminals who not only make the laws, but stack the odds in their favor by buying those who mold the legal system in their favor?
Go educate yourself. Perhaps start with a short list of GMO crops used in just about everything??
http://www.disabled-world.com/fitness/gm-foods.php
Then check out the cases Monsanto has brought to trial against a never-ending list of farmers who have tried to take on the beast when their livelihoods were destroyed by opening their mouths....
Anyone with common-sense and a worthless high-school diploma who hasn't been drinking the Kool-Aid their entire lives should be able to see that the fucking emperor is clothed in a human flesh tuxedo....
Cargo Plane Falls Out Of The Sky
This one must also and obviously recognize, given the audio unedited, the calm doggy, etc, that certain folks don't lose their shit when explosions or other such mahem erupts or arises from catastrophic FUBAR, given they're used to such a display in the regular day-to-day more than the most of us, fucking-off on the internet in our cushy podz....
Obviously, there is sound with the video. How did the driver of that car avoid a "HOLY FUCK!" moment as this was happening? That guy must have really seen some shit over there if a cargo plane exploding in front of him barely elicits any emotion.
noam chomsky-can civilisation survive capitalism?
@lantern53
your comment is so full of ignorance you should feel shame for even posting it.
disagree with chomsky is a fine position,many do,but to imply that he is not one of the most quoted and respected intellectuals on the planet is just plain stupid.
are you suggesting what america has is capitalism?
well then i submit that what america has in NOT capitalism but rather state-run capitalism or to be more accurate:corporate socialism
the problems with capitalism are well known,well understood and well documented.the problems america is experiencing now are only a mystery to those who are ignorant and rely on the sensationalist,propagandized corporate media which does nothing to inform them but rather everything to obfuscate the reality.
why? because the very corporations who steal and plunder the american working class are the very ones who bring them their daily dose of propagandized bullshit.
lap it up doggy boy...it will help ya grow into a proud and clueless corporate slave.
chomsky is a libertarian socialist.a position he has stated over and over.the problem arises when people do not even understand the terms he is speaking about,because you are correct lantern,words have meaning and one the precepts of successful propaganda is to change the meanings of words.
we need more people like chomsky who challenge the propaganda and indotcrination.people such as chomsky are not only vital but necessary.
disagree with chomsky's premise all you like but a ad hominems and straw man do not an argument break.
he could be a full blown anarchist who dabbled in black magic but it would not make his words any less true.
just because you do not LIKE what somebody is saying does not make those statements untrue.
where is the flaw in his argument?
what inaccurate statements has he made?
what historical references did he embellish?
please understand lantern i am not attacking you in any fashion.i am simply pointing out that chomsky's work has been rigorously combed over,his sources checked and vetted and found to be exceptional in their execution.
disagree with his conclusions but do so with facts,sources and a well thought out response.
knee jerk emotional arguments make you look ill-informed.
At Risk of Rape? Why Not Carry a Firearm?
Didn't watch the video yet. Wanted to reply to the subtitle of the post for all of the viewers of the video/thread to see
The real world is unfair/violent at times. We will never achieve Utopia. A woman should have the tools (be it a gun or otherwise) to defend herself if the need arises. Its far better to have something you don't need than to need something you don't have.
I am not saying that is the only solution. We should "attack" the issue from both sides by trying to prevent violence in the first place.
If my better half decided to train herself to properly use a firearm and carry it around I would support that decision. Funny enough she is learning Tae Kwon Do in case "push comes to shove."
Didn't your grandmother say "never say never?" For you to decide for everyone else that guns are never the answer is against their freedom. Perhaps guns should never be the answer for YOU specifically but don't take away the possibility of your neighbor to have a gun to protect herself from rape if thats what she chooses to do.
As Abraham Lincoln said - Those Who Sacrifice Liberty For Security Deserve Neither
Is Your Red The Same As My Red?
He kinda just reminds me of a sleight of hand magician..... without.. all.. the magic.
*I arise from the floor off-camera*
But his method of speaking also increases his audience capacity by a large factor. It's a common method in broadcast journalism to imagine a specific audience member and tailor your speaking towards her. Perhaps he's imagining an intelligent child or an elder who's hard of hearing.
Creationist Senator Can E. Coli Turn Into a Person?
It is absurd, but it is also evidently, and provably true. It is a fact. Back in the days of Darwin one could perhaps make the case that the idea of common descent was perhaps stretching it far, but the discovery and later sequencing of DNA makes it a slam dunk. There is no other even remotely reasonable conclusion you can make, but the one that says you are related to a tomato. and elephants, and chimps, and E.Coli and shrimps and everything else that has DNA. Not only do we all share the same basic system (why doesn't some species use different nucleic acids or something else to replicate?) But we share the SAME CODE. Even with our most distant cousins (something like E.Coli) have long strands of DNA code in common with us. The four nucleic acids of DNA , represented by the letters A,T,C and G are laid down by the thousands in patterns like: AAAATTCGGGTATTTATTTGCAAACCTTTT, and then we find the SAME CODE in completely "unrelated" species. But thats not all, the relatedness of the code is excactly what you would expect in the taxonomic tree, and infact it is now THE method for figuring out exactly how related one species is to another, and drawing the correct tree.
So all life IS related, which means it all has a common ancestor, which lived some 3 billion years ago. Which also means it had to be a simple form that diverged into all that we now have. And that process is evolution, and the main driving forceof evolution, by far, is natural selection. So we know that this process happens and that it can create amazing things from really much simpler things. All we need to postulate is the capability to self-replicate for those first replicators. Admittedly, this is pretty hard to envision, but we do know that all the basic building blocks (organic molecules) could arise spontaneously through non-replication. But we may never know exactly how it started, it would be something simple, like some organic molecules spontaneously forming RNA strands, which break in two and each half collects its counter-parts and form two RNA strands and so on...
Evolution is real. However to imply or believe that all things evolved from the utter basic building blocks to what we have today is absurd.